MCHR1 Rabbit Polyclonal Antibody

MCHR1 Rabbit Polyclonal Antibody

To Order Now:

MCHR1 Polyclonal Antibody
ABP59238-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein
MCHR1 Polyclonal Antibody
ABP59238-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein
MCHR1 Polyclonal Antibody
ES11507-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MCHR1 Polyclonal Antibody
ES11507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MCHR1 Rabbit pAb
A18111-100ul 100 ul
EUR 308
MCHR1 Rabbit pAb
A18111-200ul 200 ul
EUR 459
MCHR1 Rabbit pAb
A18111-20ul 20 ul
EUR 183
MCHR1 Rabbit pAb
A18111-50ul 50 ul
EUR 223
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
DLR-MCHR1-Hu-48T 48T
EUR 517
  • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
DLR-MCHR1-Hu-96T 96T
EUR 673
  • Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids.
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RDR-MCHR1-Hu-48Tests 48 Tests
EUR 544
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RDR-MCHR1-Hu-96Tests 96 Tests
EUR 756
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RD-MCHR1-Hu-48Tests 48 Tests
EUR 521
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit
RD-MCHR1-Hu-96Tests 96 Tests
EUR 723
MCHR1 antibody
70R-18438 50 ul
EUR 435
Description: Rabbit polyclonal MCHR1 antibody
MCHR1 Antibody
37720-100ul 100ul
EUR 252
MCHR1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
MCHR1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
MCHR1 Antibody
DF2819 200ul
EUR 304
Description: MCHR1 antibody detects endogenous levels of total MCHR1.
MCHR1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MCHR1 Antibody
ABD2819 100 ug
EUR 438
Polyclonal MCHR1 Antibody (N-Terminus)
APC00068G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal MCHR1 Antibody (C-Terminus)
APS00038G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal MCHR1 Antibody (C-term)
APR12512G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal MCHR1 Antibody (N-Terminus)
APR12513G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications:
MCHR1 Conjugated Antibody
C37720 100ul
EUR 397
anti- MCHR1 antibody
FNab05050 100µg
EUR 585
  • Immunogen: melanin-concentrating hormone receptor 1
  • Uniprot ID: Q99705
  • Gene ID: 2847
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1
anti- MCHR1 antibody
FNab05051 100µg
EUR 505.25
  • Immunogen: melanin-concentrating hormone receptor 1
  • Uniprot ID: Q99705
  • Gene ID: 2847
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against MCHR1
Anti-MCHR1 antibody
PAab05050 100 ug
EUR 412
Anti-MCHR1 antibody
PAab05051 100 ug
EUR 355
Anti-MCHR1 antibody
STJ11100082 100 µl
EUR 277
Anti-MCHR1 antibody
STJ192665 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MCHR1
Mchr1/ Rat Mchr1 ELISA Kit
ELI-03776r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MCHR1 Blocking Peptide
DF2819-BP 1mg
EUR 195
MCHR1 cloning plasmid
CSB-CL013584HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1269
  • Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc
  • Show more
Description: A cloning plasmid for the MCHR1 gene.
MCHr1 antagonist 2
HY-100321 1mg
EUR 696
MCHr1 antagonist 1
HY-U00353 1mg
EUR 1813
ELA-E1146h 96 Tests
EUR 824
EF003698 96 Tests
EUR 689
Rat MCHR1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human MCHR1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse MCHR1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MCHR1 Recombinant Protein (Human)
RP018973 100 ug Ask for price
MCHR1 Recombinant Protein (Mouse)
RP149813 100 ug Ask for price
MCHR1 Recombinant Protein (Rat)
RP211109 100 ug Ask for price
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit
E04M0388-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx025849-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
abx025849-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MCHR1 Rabbit Polyclonal Antibody