MCHR1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
MCHR1 Polyclonal Antibody |
ES11507-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MCHR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MCHR1 Polyclonal Antibody |
ABP59238-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein |
MCHR1 Polyclonal Antibody |
ABP59238-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein |
MCHR1 Polyclonal Antibody |
ABP59238-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MCHR1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCHR1 from Human, Mouse, Rat. This MCHR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCHR1 protein |
MCHR1 Rabbit pAb |
A18111-100ul |
Abclonal |
100 ul |
EUR 308 |
MCHR1 Rabbit pAb |
A18111-200ul |
Abclonal |
200 ul |
EUR 459 |
MCHR1 Rabbit pAb |
A18111-20ul |
Abclonal |
20 ul |
EUR 183 |
MCHR1 Rabbit pAb |
A18111-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
DLR-MCHR1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids. |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
DLR-MCHR1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanin Concentrating Hormone Receptor 1 (MCHR1) in samples from tissue homogenates or other biological fluids. |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
RD-MCHR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
RD-MCHR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
RDR-MCHR1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Melanin Concentrating Hormone Receptor 1 (MCHR1) ELISA Kit |
RDR-MCHR1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
MCHR1 Antibody |
37720-100ul |
SAB |
100ul |
EUR 252 |
MCHR1 antibody |
70R-18438 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MCHR1 antibody |
MCHR1 Antibody |
1-CSB-PA998557 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MCHR1 Antibody |
DF2819 |
Affbiotech |
200ul |
EUR 304 |
Description: MCHR1 antibody detects endogenous levels of total MCHR1. |
MCHR1 Antibody |
1-CSB-PA013584GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MCHR1 Antibody |
1-CSB-PA132314 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MCHR1. Recognizes MCHR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
Polyclonal MCHR1 Antibody (N-Terminus) |
APC00068G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal MCHR1 Antibody (C-Terminus) |
APS00038G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal MCHR1 Antibody (C-term) |
APR12512G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal MCHR1 Antibody (N-Terminus) |
APR12513G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCHR1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
MCHR1 Conjugated Antibody |
C37720 |
SAB |
100ul |
EUR 397 |
anti- MCHR1 antibody |
FNab05050 |
FN Test |
100µg |
EUR 585 |
- Immunogen: melanin-concentrating hormone receptor 1
- Uniprot ID: Q99705
- Gene ID: 2847
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against MCHR1 |
anti- MCHR1 antibody |
FNab05051 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: melanin-concentrating hormone receptor 1
- Uniprot ID: Q99705
- Gene ID: 2847
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against MCHR1 |
Anti-MCHR1 antibody |
STJ192665 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MCHR1 |
MCHR1 siRNA |
20-abx903189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 siRNA |
20-abx923721 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 siRNA |
20-abx923722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 cloning plasmid |
CSB-CL013584HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1269
- Sequence: atgtcagtgggagccatgaagaagggagtggggagggcagttgggcttggaggcggcagcggctgccaggctacggaggaagacccccttcccgactgcggggcttgcgctccgggacaaggtggcaggcgctggaggctgccgcagcctgcgtgggtggaggggagctcagctc
- Show more
|
Description: A cloning plasmid for the MCHR1 gene. |
MCHR1 Blocking Peptide |
DF2819-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse MCHR1 shRNA Plasmid |
20-abx980518 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat MCHR1 shRNA Plasmid |
20-abx986797 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MCHR1 shRNA Plasmid |
20-abx951910 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MCHR1 Recombinant Protein (Human) |
RP018973 |
ABM |
100 ug |
Ask for price |
MCHR1 Recombinant Protein (Rat) |
RP211109 |
ABM |
100 ug |
Ask for price |
MCHR1 Recombinant Protein (Mouse) |
RP149813 |
ABM |
100 ug |
Ask for price |
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
E04M0388-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
E04M0388-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Melanin concenting hormone receptor 1(MCHR1) ELISA kit |
E04M0388-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Melanin concenting hormone receptor 1(MCHR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
20-abx113654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
abx025849-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
abx025849-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
20-abx173523 |
Abbexa |
|
|
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
20-abx177519 |
Abbexa |
|
|
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
20-abx242224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanin Concentrating Hormone Receptor 1 (MCHR1) Antibody |
20-abx242225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCHR1 Rabbit Polyclonal Antibody