GSTM2 Rabbit Polyclonal Antibody

GSTM2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GSTM2 Polyclonal Antibody
ABP58730-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GSTM2 protein Applications tips:
Description: A polyclonal antibody for detection of GSTM2 from Human. This GSTM2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM2 protein

GSTM2 Polyclonal Antibody
ABP58730-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GSTM2 protein Applications tips:
Description: A polyclonal antibody for detection of GSTM2 from Human. This GSTM2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM2 protein

GSTM2 Rabbit pAb
A13496-100ul	Abclonal	100 ul	EUR 308

GSTM2 Rabbit pAb
A13496-200ul	Abclonal	200 ul	EUR 459

GSTM2 Rabbit pAb
A13496-20ul	Abclonal	20 ul	EUR 183

GSTM2 Rabbit pAb
A13496-50ul	Abclonal	50 ul	EUR 223

GSTM2 antibody
70R-49834	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal GSTM2 antibody

GSTM2 antibody
70R-2848	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GSTM2 antibody

GSTM2 Antibody
ABD6339	Lifescience Market	100 ug	EUR 438

GSTM2 Antibody
43377-100ul	SAB	100ul	EUR 252

GSTM2 Antibody
32228-100ul	SAB	100ul	EUR 252

GSTM2 Antibody
DF6339	Affbiotech	200ul	EUR 304
Description: GSTM2 Antibody detects endogenous levels of total GSTM2.

GSTM2 Antibody
CSB-PA009981KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSTM2 Antibody
CSB-PA009981KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody
AMM05005G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

GSTM2 Conjugated Antibody
C43377	SAB	100ul	EUR 397

GSTM2 Conjugated Antibody
C32228	SAB	100ul	EUR 397

Human GSTM2 Antibody
33169-05111	AssayPro	150 ug	EUR 261

Anti-GSTM2 antibody
STJ115457	St John's Laboratory	100 µl	EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs.

Anti-GSTM2 antibody
STJ193064	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM2

Gstm2/ Rat Gstm2 ELISA Kit
ELI-27914r	Lifescience Market	96 Tests	EUR 886

GSTM2 siRNA
20-abx902354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918820	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918821	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-GSTM1 / GSTM2 antibody
STJ70642	St John's Laboratory	100 µg	EUR 359

GSTM2 cloning plasmid
CSB-CL009981HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: ATGCCCATGACACTGGGGTACTGGAACATCCGCGGGCTGGCCCATTCCATCCGCCTGCTCCTGGAATACACAGACTCAAGCTACGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAA Show more
Description: A cloning plasmid for the GSTM2 gene.

GSTM2 Blocking Peptide
20-abx062709	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

GSTM2 Blocking Peptide
33R-9250	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM2 antibody, catalog no. 70R-2848

GSTM2 Blocking Peptide
DF6339-BP	Affbiotech	1mg	EUR 195

Anti-GSTM2 (1E10)
YF-MA10392	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GSTM2

Human GSTM2 Antibody (Biotin Conjugate)
33169-05121	AssayPro	150 ug	EUR 369

Human GSTM2 AssayLite Antibody (FITC Conjugate)
33169-05141	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (RPE Conjugate)
33169-05151	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (APC Conjugate)
33169-05161	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (PerCP Conjugate)
33169-05171	AssayPro	150 ug	EUR 471

Rat GSTM2 shRNA Plasmid
20-abx984489	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSTM2 protein (His tag)
80R-1490	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human GSTM2 protein

Mouse GSTM2 shRNA Plasmid
20-abx970690	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GSTM2 shRNA Plasmid
20-abx951991	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSTM2 Recombinant Protein (Human)
RP039664	ABM	100 ug	Ask for price

GSTM2 Recombinant Protein (Rat)
RP203852	ABM	100 ug	Ask for price

GSTM2 Recombinant Protein (Mouse)
RP140255	ABM	100 ug	Ask for price

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse)
4-PAA657Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat)
4-PAA657Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2)

Rabbit Glutathione S Transferase Mu 2 (GSTM2) ELISA Kit
abx362484-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC
4-PAA657Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA657Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Cy3
4-PAA657Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), FITC
4-PAA657Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), HRP
4-PAA657Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), PE
4-PAA657Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC
4-PAA657Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Biotinylated
4-PAA657Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Cy3
4-PAA657Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), FITC
4-PAA657Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), HRP
4-PAA657Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), PE
4-PAA657Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Monoclonal GSTM2 Antibody (clone 1E10), Clone: 1E10
AMM05250G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human GSTM2 (clone 1E10). The antibodies are raised in Mouse and are from clone 1E10. This antibody is applicable in WB and IHC-P, E

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx117065-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx001119	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx009183	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx340199-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gstm2 ORF Vector (Rat) (pORF)
ORF067952	ABM	1.0 ug DNA	EUR 506

Gstm2 ORF Vector (Mouse) (pORF)
ORF046753	ABM	1.0 ug DNA	EUR 506

GSTM2 ORF Vector (Human) (pORF)
ORF013222	ABM	1.0 ug DNA	EUR 354

GSTM2 ELISA Kit (Human) (OKCA01257)
OKCA01257	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA657Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA657Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104058	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104059	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104060	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx172617	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

GSTM2 sgRNA CRISPR Lentivector set (Human)
K0913701	ABM	3 x 1.0 ug	EUR 339

Gstm2 sgRNA CRISPR Lentivector set (Mouse)
K3274801	ABM	3 x 1.0 ug	EUR 339

Gstm2 sgRNA CRISPR Lentivector set (Rat)
K6893201	ABM	3 x 1.0 ug	EUR 339

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAA657Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody (Biotin)
20-abx273314	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAA657Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAA657Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAA657Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAA657Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAA657Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAA657Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0913702	ABM	1.0 ug DNA	EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0913703	ABM	1.0 ug DNA	EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0913704	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3274802	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3274803	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3274804	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6893202	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6893203	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6893204	ABM	1.0 ug DNA	EUR 154

GSTM2 Protein Vector (Human) (pPB-C-His)
PV052885	ABM	500 ng	EUR 481

GSTM2 Protein Vector (Human) (pPB-N-His)
PV052886	ABM	500 ng	EUR 481

GSTM2 Protein Vector (Human) (pPM-C-HA)
PV052887	ABM	500 ng	EUR 481

GSTM2 Protein Vector (Human) (pPM-C-His)
PV052888	ABM	500 ng	EUR 481

GSTM2 Protein Vector (Rat) (pPB-C-His)
PV271806	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPB-N-His)
PV271807	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-HA)
PV271808	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-His)
PV271809	ABM	500 ng	EUR 603

Recombinant Human GSTM2 Protein, His, E.coli-1mg
QP10659-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human GSTM2 Protein, His, E.coli-20ug
QP10659-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human GSTM2 Protein, His, E.coli-5ug
QP10659-5ug	EnQuireBio	5ug	EUR 155

GSTM2 Protein Vector (Mouse) (pPB-C-His)
PV187010	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Mouse) (pPB-N-His)
PV187011	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Mouse) (pPM-C-HA)
PV187012	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Mouse) (pPM-C-His)
PV187013	ABM	500 ng	EUR 603

Gstm2 3'UTR Luciferase Stable Cell Line
TU205517	ABM	1.0 ml	Ask for price

Gstm2 3'UTR GFP Stable Cell Line
TU159178	ABM	1.0 ml	Ask for price

GSTM2 3'UTR Luciferase Stable Cell Line
TU009388	ABM	1.0 ml	EUR 1394

Gstm2 3'UTR Luciferase Stable Cell Line
TU109178	ABM	1.0 ml	Ask for price

GSTM2 3'UTR GFP Stable Cell Line
TU059388	ABM	1.0 ml	EUR 1394

Gstm2 3'UTR GFP Stable Cell Line
TU255517	ABM	1.0 ml	Ask for price

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC-Cy7
4-PAA657Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

GSTM2 Rabbit Polyclonal Antibody