GSTM2 Rabbit Polyclonal Antibody

GSTM2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GSTM2 Polyclonal Antibody
ES11906-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GSTM2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM2 Polyclonal Antibody
ES11906-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GSTM2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM2 Rabbit pAb
A13496-100ul 100 ul
EUR 308

GSTM2 Rabbit pAb
A13496-200ul 200 ul
EUR 459

GSTM2 Rabbit pAb
A13496-20ul 20 ul
EUR 183

GSTM2 Rabbit pAb
A13496-50ul 50 ul
EUR 223

GSTM2 antibody
70R-2848 50 ug
EUR 467
Description: Rabbit polyclonal GSTM2 antibody

GSTM2 Antibody
32228-100ul 100ul
EUR 252

GSTM2 Antibody
43377-100ul 100ul
EUR 252

GSTM2 Antibody
DF6339 200ul
EUR 304
Description: GSTM2 Antibody detects endogenous levels of total GSTM2.

GSTM2 antibody
70R-49834 100 ul
EUR 244
Description: Purified Polyclonal GSTM2 antibody

GSTM2 Antibody
CSB-PA009981KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSTM2 Antibody
CSB-PA009981KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSTM2 Antibody
ABD6339 100 ug
EUR 438

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody
AMM05005G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

Human GSTM2 Antibody
33169-05111 150 ug
EUR 261

GSTM2 Conjugated Antibody
C43377 100ul
EUR 397

GSTM2 Conjugated Antibody
C32228 100ul
EUR 397

Anti-GSTM2 antibody
STJ115457 100 µl
EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs.

Anti-GSTM2 antibody
STJ193064 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM2

Gstm2/ Rat Gstm2 ELISA Kit
ELI-27914r 96 Tests
EUR 886

GSTM2 siRNA
20-abx902354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918820
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918821
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-GSTM1 / GSTM2 antibody
STJ70642 100 µg
EUR 359

GSTM2 Blocking Peptide
33R-9250 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM2 antibody, catalog no. 70R-2848

GSTM2 Blocking Peptide
DF6339-BP 1mg
EUR 195

GSTM2 Blocking Peptide
20-abx062709
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSTM2 cloning plasmid
CSB-CL009981HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: ATGCCCATGACACTGGGGTACTGGAACATCCGCGGGCTGGCCCATTCCATCCGCCTGCTCCTGGAATACACAGACTCAAGCTACGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAA
  • Show more
Description: A cloning plasmid for the GSTM2 gene.

Anti-GSTM2 (1E10)
YF-MA10392 100 ug
EUR 363
Description: Mouse monoclonal to GSTM2

Human GSTM2 Antibody (Biotin Conjugate)
33169-05121 150 ug
EUR 369

Human GSTM2 AssayLite Antibody (FITC Conjugate)
33169-05141 150 ug
EUR 428

Human GSTM2 AssayLite Antibody (RPE Conjugate)
33169-05151 150 ug
EUR 428

Human GSTM2 AssayLite Antibody (APC Conjugate)
33169-05161 150 ug
EUR 428

Human GSTM2 AssayLite Antibody (PerCP Conjugate)
33169-05171 150 ug
EUR 471

GSTM2 protein (His tag)
80R-1490 100 ug
EUR 305
Description: Purified recombinant Human GSTM2 protein

Rat GSTM2 shRNA Plasmid
20-abx984489
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSTM2 shRNA Plasmid
20-abx951991
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GSTM2 shRNA Plasmid
20-abx970690
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSTM2 Recombinant Protein (Human)
RP039664 100 ug Ask for price

GSTM2 Recombinant Protein (Rat)
RP203852 100 ug Ask for price

GSTM2 Recombinant Protein (Mouse)
RP140255 100 ug Ask for price

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse)
4-PAA657Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat)
4-PAA657Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2)

Rabbit Glutathione S Transferase Mu 2 (GSTM2) ELISA Kit
abx362484-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC
4-PAA657Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA657Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Cy3
4-PAA657Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), FITC
4-PAA657Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), HRP
4-PAA657Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), PE
4-PAA657Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC
4-PAA657Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Biotinylated
4-PAA657Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Cy3
4-PAA657Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), FITC
4-PAA657Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), HRP
4-PAA657Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), PE
4-PAA657Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx009183
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx117065-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx340199-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Monoclonal GSTM2 Antibody (clone 1E10), Clone: 1E10
AMM05250G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human GSTM2 (clone 1E10). The antibodies are raised in Mouse and are from clone 1E10. This antibody is applicable in WB and IHC-P, E

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx001119
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gstm2 ORF Vector (Rat) (pORF)
ORF067952 1.0 ug DNA
EUR 506

GSTM2 ORF Vector (Human) (pORF)
ORF013222 1.0 ug DNA
EUR 354

Gstm2 ORF Vector (Mouse) (pORF)
ORF046753 1.0 ug DNA
EUR 506

GSTM2 ELISA Kit (Human) (OKCA01257)
OKCA01257 96 Wells
EUR 846
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA657Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Leu5~Arg202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA657Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met1~Lys218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104058
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104059
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104060
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx172617
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Gstm2 sgRNA CRISPR Lentivector set (Rat)
K6893201 3 x 1.0 ug
EUR 339

Gstm2 sgRNA CRISPR Lentivector set (Mouse)
K3274801 3 x 1.0 ug
EUR 339

GSTM2 sgRNA CRISPR Lentivector set (Human)
K0913701 3 x 1.0 ug
EUR 339

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAA657Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody (Biotin)
20-abx273314
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAA657Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAA657Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAA657Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAA657Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAA657Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAA657Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm2 (Met3~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6893202 1.0 ug DNA
EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6893203 1.0 ug DNA
EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6893204 1.0 ug DNA
EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3274802 1.0 ug DNA
EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3274803 1.0 ug DNA
EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3274804 1.0 ug DNA
EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0913702 1.0 ug DNA
EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0913703 1.0 ug DNA
EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0913704 1.0 ug DNA
EUR 154

GSTM2 Protein Vector (Rat) (pPB-C-His)
PV271806 500 ng
EUR 603

GSTM2 Protein Vector (Rat) (pPB-N-His)
PV271807 500 ng
EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-HA)
PV271808 500 ng
EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-His)
PV271809 500 ng
EUR 603

GSTM2 Rabbit Polyclonal Antibody