GPR64 Rabbit Polyclonal Antibody

GPR64 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GPR64 Polyclonal Antibody

ES11499-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR64 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR64 Antibody

36911-100ul 100ul
EUR 252

GPR64 Antibody

1-CSB-PA912224
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR64. Recognizes GPR64 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

GPR64 Antibody

DF2758 200ul
EUR 304
Description: GPR64 antibody detects endogenous levels of total GPR64.

GPR64 Antibody

ABD2758 100 ug
EUR 438

Gpr64/ Rat Gpr64 ELISA Kit

ELI-31709r 96 Tests
EUR 886

Polyclonal ADGRG2 / GPR64 Antibody (C-Terminus)

APR14845G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADGRG2 / GPR64 (C-Terminus). This antibody is tested and proven to work in the following applications:

GPR64 Conjugated Antibody

C36911 100ul
EUR 397

Anti-GPR64 antibody

STJ192657 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR64

GPR64 siRNA

20-abx902288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR64 siRNA

20-abx918545
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR64 siRNA

20-abx918546
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR64 Blocking Peptide

DF2758-BP 1mg
EUR 195

GPR64 cloning plasmid

CSB-CL811638HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2853
  • Sequence: ATGGTTTTCTCTGTCAGGCAGTGTGGCCATGTTGGCAGAACTGAAGAAGTTTTACTGACGTTCAAGATATTCCTTGTCATCATTTGTCTTCATGTCGTTCTGGTAACATCCCTGGAAGAAGATACTGATAATTCCAGTTTGTCACCACCACCTGAGGTTGAAACAACAAGCCTCA
  • Show more
Description: A cloning plasmid for the GPR64 gene.

Rat GPR64 shRNA Plasmid

20-abx988100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR64 shRNA Plasmid

20-abx956849
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GPR64 shRNA Plasmid

20-abx982267
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

G-Protein Coupled Receptor 64 (GPR64) Antibody

abx147547-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Gpr64 ORF Vector (Rat) (pORF)

ORF067819 1.0 ug DNA
EUR 506

GPR64 ORF Vector (Human) (pORF)

ORF013198 1.0 ug DNA
EUR 354

Gpr64 ORF Vector (Mouse) (pORF)

ORF046562 1.0 ug DNA
EUR 506

Gpr64 ORF Vector (Mouse) (pORF)

ORF046563 1.0 ug DNA
EUR 506

Gpr64 ORF Vector (Mouse) (pORF)

ORF046564 1.0 ug DNA
EUR 506

Gpr64 ORF Vector (Mouse) (pORF)

ORF046565 1.0 ug DNA
EUR 506

Gpr64 sgRNA CRISPR Lentivector set (Rat)

K7196001 3 x 1.0 ug
EUR 339

Gpr64 sgRNA CRISPR Lentivector set (Mouse)

K4391901 3 x 1.0 ug
EUR 339

GPR64 sgRNA CRISPR Lentivector set (Human)

K0892501 3 x 1.0 ug
EUR 339

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7196002 1.0 ug DNA
EUR 154

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7196003 1.0 ug DNA
EUR 154

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7196004 1.0 ug DNA
EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4391902 1.0 ug DNA
EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4391903 1.0 ug DNA
EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4391904 1.0 ug DNA
EUR 154

GPR64 sgRNA CRISPR Lentivector (Human) (Target 1)

K0892502 1.0 ug DNA
EUR 154

GPR64 sgRNA CRISPR Lentivector (Human) (Target 2)

K0892503 1.0 ug DNA
EUR 154

GPR64 sgRNA CRISPR Lentivector (Human) (Target 3)

K0892504 1.0 ug DNA
EUR 154

GPR64 Protein Vector (Rat) (pPB-C-His)

PV271274 500 ng
EUR 1191

GPR64 Protein Vector (Rat) (pPB-N-His)

PV271275 500 ng
EUR 1191

GPR64 Protein Vector (Rat) (pPM-C-HA)

PV271276 500 ng
EUR 1191

GPR64 Protein Vector (Rat) (pPM-C-His)

PV271277 500 ng
EUR 1191

GPR64 Protein Vector (Mouse) (pPB-C-His)

PV186246 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPB-N-His)

PV186247 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-HA)

PV186248 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-His)

PV186249 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPB-C-His)

PV186250 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPB-N-His)

PV186251 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-HA)

PV186252 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-His)

PV186253 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPB-C-His)

PV186254 500 ng
EUR 1065

GPR64 Protein Vector (Mouse) (pPB-N-His)

PV186255 500 ng
EUR 1065

GPR64 Rabbit Polyclonal Antibody