GPR64 Rabbit Polyclonal Antibody

GPR64 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GPR64 Polyclonal Antibody
ABP58696-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GPR64 protein Applications tips:
Description: A polyclonal antibody for detection of GPR64 from Human, Mouse, Rat. This GPR64 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR64 protein

GPR64 Antibody
ABD2758	Lifescience Market	100 ug	EUR 438

GPR64 Antibody
36911-100ul	SAB	100ul	EUR 252

GPR64 Antibody
1-CSB-PA912224	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR64. Recognizes GPR64 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

GPR64 Antibody
DF2758	Affbiotech	200ul	EUR 304
Description: GPR64 antibody detects endogenous levels of total GPR64.

Gpr64/ Rat Gpr64 ELISA Kit
ELI-31709r	Lifescience Market	96 Tests	EUR 886

Polyclonal ADGRG2 / GPR64 Antibody (C-Terminus)
APR14845G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADGRG2 / GPR64 (C-Terminus). This antibody is tested and proven to work in the following applications:

GPR64 Conjugated Antibody
C36911	SAB	100ul	EUR 397

Anti-GPR64 antibody
STJ192657	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPR64

GPR64 siRNA
20-abx902288	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR64 siRNA
20-abx918545	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR64 siRNA
20-abx918546	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR64 Blocking Peptide
DF2758-BP	Affbiotech	1mg	EUR 195

GPR64 cloning plasmid
CSB-CL811638HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2853 Sequence: ATGGTTTTCTCTGTCAGGCAGTGTGGCCATGTTGGCAGAACTGAAGAAGTTTTACTGACGTTCAAGATATTCCTTGTCATCATTTGTCTTCATGTCGTTCTGGTAACATCCCTGGAAGAAGATACTGATAATTCCAGTTTGTCACCACCACCTGAGGTTGAAACAACAAGCCTCA Show more
Description: A cloning plasmid for the GPR64 gene.

Rat GPR64 shRNA Plasmid
20-abx988100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPR64 shRNA Plasmid
20-abx956849	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GPR64 shRNA Plasmid
20-abx982267	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

G-Protein Coupled Receptor 64 (GPR64) Antibody
abx147547-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Gpr64 ORF Vector (Rat) (pORF)
ORF067819	ABM	1.0 ug DNA	EUR 506

Gpr64 ORF Vector (Mouse) (pORF)
ORF046562	ABM	1.0 ug DNA	EUR 506

Gpr64 ORF Vector (Mouse) (pORF)
ORF046563	ABM	1.0 ug DNA	EUR 506

Gpr64 ORF Vector (Mouse) (pORF)
ORF046564	ABM	1.0 ug DNA	EUR 506

Gpr64 ORF Vector (Mouse) (pORF)
ORF046565	ABM	1.0 ug DNA	EUR 506

GPR64 ORF Vector (Human) (pORF)
ORF013198	ABM	1.0 ug DNA	EUR 354

GPR64 sgRNA CRISPR Lentivector set (Human)
K0892501	ABM	3 x 1.0 ug	EUR 339

Gpr64 sgRNA CRISPR Lentivector set (Mouse)
K4391901	ABM	3 x 1.0 ug	EUR 339

Gpr64 sgRNA CRISPR Lentivector set (Rat)
K7196001	ABM	3 x 1.0 ug	EUR 339

GPR64 sgRNA CRISPR Lentivector (Human) (Target 1)
K0892502	ABM	1.0 ug DNA	EUR 154

GPR64 sgRNA CRISPR Lentivector (Human) (Target 2)
K0892503	ABM	1.0 ug DNA	EUR 154

GPR64 sgRNA CRISPR Lentivector (Human) (Target 3)
K0892504	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4391902	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4391903	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4391904	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7196002	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7196003	ABM	1.0 ug DNA	EUR 154

Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7196004	ABM	1.0 ug DNA	EUR 154

GPR64 Protein Vector (Human) (pPB-C-His)
PV052789	ABM	500 ng	EUR 481

GPR64 Protein Vector (Human) (pPB-N-His)
PV052790	ABM	500 ng	EUR 481

GPR64 Protein Vector (Human) (pPM-C-HA)
PV052791	ABM	500 ng	EUR 481

GPR64 Protein Vector (Human) (pPM-C-His)
PV052792	ABM	500 ng	EUR 481

GPR64 Protein Vector (Rat) (pPB-C-His)
PV271274	ABM	500 ng	EUR 1191

GPR64 Protein Vector (Rat) (pPB-N-His)
PV271275	ABM	500 ng	EUR 1191

GPR64 Protein Vector (Rat) (pPM-C-HA)
PV271276	ABM	500 ng	EUR 1191

GPR64 Protein Vector (Rat) (pPM-C-His)
PV271277	ABM	500 ng	EUR 1191

GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186246	ABM	500 ng	EUR 1065

GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186247	ABM	500 ng	EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-HA)
PV186248	ABM	500 ng	EUR 1065

GPR64 Protein Vector (Mouse) (pPM-C-His)
PV186249	ABM	500 ng	EUR 1065

GPR64 Protein Vector (Mouse) (pPB-C-His)
PV186250	ABM	500 ng	EUR 1065

GPR64 Protein Vector (Mouse) (pPB-N-His)
PV186251	ABM	500 ng	EUR 1065

GPR64 Rabbit Polyclonal Antibody