SLIT2 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
SLIT2 Polyclonal Antibody |
ES11862-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SLIT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SLIT2 Rabbit pAb |
A15353-100ul |
Abclonal |
100 ul |
EUR 308 |
SLIT2 Rabbit pAb |
A15353-200ul |
Abclonal |
200 ul |
EUR 459 |
SLIT2 Rabbit pAb |
A15353-20ul |
Abclonal |
20 ul |
EUR 183 |
SLIT2 Rabbit pAb |
A15353-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
DLR-Slit2-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
RD-Slit2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Slit Homolog 2 (Slit2) ELISA Kit |
RDR-Slit2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit Slit2 ELISA Kit |
ERTS0119 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal SLIT2 Antibody (internal region) |
APR13393G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLIT2 (internal region). This antibody is tested and proven to work in the following applications: |
SLIT2 antibody |
70R-21701 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SLIT2 antibody |
SLIT2 Antibody |
37951-100ul |
SAB |
100ul |
EUR 252 |
SLIT2 Antibody |
1-CSB-PA136864 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
SLIT2 Antibody |
DF7991 |
Affbiotech |
200ul |
EUR 304 |
Description: SLIT2 Antibody detects endogenous levels of total SLIT2. |
SLIT2 Antibody |
1-CSB-PA245341 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
SLIT2 Antibody |
1-CSB-PA021768GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Anti-SLIT2 Antibody |
A01627 |
BosterBio |
100ug/200ul |
EUR 397 |
Description: Goat Polyclonal SLIT2 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
SLIT2-Specific Antibody |
abx237981-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
SLIT2 Conjugated Antibody |
C37951 |
SAB |
100ul |
EUR 397 |
anti- SLIT2 antibody |
FNab07981 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: slit homolog 2
- Uniprot ID: O94813
- Gene ID: 9353
- Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
|
Description: Antibody raised against SLIT2 |
Anti-SLIT2 antibody |
STJ117548 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants. |
Anti-SLIT2 antibody |
STJ193020 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SLIT2 |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human) |
4-PAA672Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2) |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human) |
4-PAA672Hu02 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2) |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse) |
4-PAA672Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2) |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse) |
4-PAA672Mu02 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2) |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat) |
4-PAA672Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2) |
SLIT2 siRNA |
20-abx934241 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SLIT2 siRNA |
20-abx934242 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Slit2 |
YF-PA25316 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Slit2 |
Anti-Slit2 Monoclonal Antibody |
M01627 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal Slit2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC |
4-PAA672Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated |
4-PAA672Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3 |
4-PAA672Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC |
4-PAA672Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP |
4-PAA672Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE |
4-PAA672Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC |
4-PAA672Hu02-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated |
4-PAA672Hu02-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3 |
4-PAA672Hu02-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC |
4-PAA672Hu02-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP |
4-PAA672Hu02-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE |
4-PAA672Hu02-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC |
4-PAA672Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA672Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3 |
4-PAA672Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC |
4-PAA672Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP |
4-PAA672Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE |
4-PAA672Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC |
4-PAA672Mu02-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA672Mu02-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3 |
4-PAA672Mu02-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC |
4-PAA672Mu02-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP |
4-PAA672Mu02-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE |
4-PAA672Mu02-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC |
4-PAA672Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Biotinylated |
4-PAA672Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Biotin. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Cy3 |
4-PAA672Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Cy3. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), FITC |
4-PAA672Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with FITC. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), HRP |
4-PAA672Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with HRP. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), PE |
4-PAA672Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with PE. |
Rabbit Slit Homolog 2 (Slit2) ELISA Kit |
abx362683-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Slit Homolog 2 (SLIT2) Antibody |
20-abx214142 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx101381 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx101382 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx101383 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx101384 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx129328 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Slit Homolog 2 (Slit2) Antibody |
20-abx174568 |
Abbexa |
|
|
|
Slit Homolog 2 (Slit2) Antibody |
20-abx174569 |
Abbexa |
|
|
|
Slit Homolog 2 (SLIT2) Antibody |
20-abx242002 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Slit Homolog 2 (SLIT2) Antibody |
abx431593-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
SLIT2 Blocking Peptide |
DF7991-BP |
Affbiotech |
1mg |
EUR 195 |
SLIT2 cloning plasmid |
CSB-CL021768HU-10ug |
Cusabio |
10ug |
EUR 1790 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4590
- Sequence: atgcgcggcgttggctggcagatgctgtccctgtcgctggggttagtgctggcgatcctgaacaaggtggcaccgcaggcgtgcccggcgcagtgctcttgctcgggcagcacagtggactgtcacgggctggcgctgcgcagcgtgcccaggaatatcccccgcaacaccgaga
- Show more
|
Description: A cloning plasmid for the SLIT2 gene. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA672Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HK1 (Val1160~Cys1333)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAA672Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1416~Val1528)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA672Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Gln31~His197)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA672Mu02-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7. |
Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA672Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Slit2 (Asn209~Gly374)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7. |
Slit Homolog 2 Protein (SLIT2) Antibody |
20-abx115592 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Slit Homolog 2 (Slit2) Antibody (Biotin) |
20-abx272026 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Slit Homolog 2 (Slit2) Antibody (Biotin) |
20-abx272728 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1219.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Slit Homolog 2 (Slit2) Antibody (Biotin) |
20-abx273202 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Slit2 ELISA Kit |
201-12-0662 |
SunredBio |
96 tests |
EUR 440 |
- This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Slit2 ELISA Kit |
EHS0119 |
Abclonal |
96Tests |
EUR 521 |
Bovine Slit2 ELISA Kit |
EBS0119 |
Abclonal |
96Tests |
EUR 521 |
Anserini Slit2 ELISA Kit |
EAS0119 |
Abclonal |
96Tests |
EUR 521 |
Chicken Slit2 ELISA Kit |
ECKS0119 |
Abclonal |
96Tests |
EUR 521 |
Canine Slit2 ELISA Kit |
ECS0119 |
Abclonal |
96Tests |
EUR 521 |
Goat Slit2 ELISA Kit |
EGTS0119 |
Abclonal |
96Tests |
EUR 521 |
Human Slit2 ELISA Kit |
CSB-E11038h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Slit2 ELISA Kit |
1-CSB-E11038h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Slit2 ELISA Kit |
CSB-E11039m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Slit2 ELISA Kit |
1-CSB-E11039m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse SLIT2 shRNA Plasmid |
20-abx972767 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SLIT2 shRNA Plasmid |
20-abx956191 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine Slit2 ELISA Kit |
EPS0119 |
Abclonal |
96Tests |
EUR 521 |
Sheep Slit2 ELISA Kit |
ESS0119 |
Abclonal |
96Tests |
EUR 521 |
Mouse Slit2 ELISA Kit         |
GA-E0154MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Slit2 ELISA Kit         |
GA-E0154MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Rat Slit2 ELISA Kit |
ERS0119 |
Abclonal |
96Tests |
EUR 521 |
Monkey Slit2 ELISA Kit |
EMKS0119 |
Abclonal |
96Tests |
EUR 521 |
Mouse Slit2 ELISA Kit |
EMS0119 |
Abclonal |
96Tests |
EUR 521 |
Active Slit Homolog 2 (Slit2) |
4-APA672Ra01 |
Cloud-Clone |
-
EUR 829.34
-
EUR 325.00
-
EUR 2835.04
-
EUR 1011.68
-
EUR 1923.36
-
EUR 618.00
-
EUR 6937.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVC1
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.9kDa
- Isoelectric Point: 6.8
|
Description: Recombinant Rat Slit Homolog 2 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Mouse SLIT2 PicoKine ELISA Kit |
EK1860 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse SLIT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
Guinea Pig Slit2 ELISA Kit |
EGS0119 |
Abclonal |
96Tests |
EUR 521 |
Slit2 ORF Vector (Rat) (pORF) |
ORF076650 |
ABM |
1.0 ug DNA |
EUR 2080 |
SLIT2 ORF Vector (Human) (pORF) |
ORF014521 |
ABM |
1.0 ug DNA |
EUR 95 |
Slit2 ORF Vector (Mouse) (pORF) |
ORF057900 |
ABM |
1.0 ug DNA |
EUR 1572 |
Recombinant Human Slit2-N Protein |
PROTO94813 |
BosterBio |
25ug |
EUR 317 |
Description: Slit2 is a member of the Slit family that signals through the Roundabout (Robo) receptor as a repellent for axon guidance and neuronal migration, and can also act as a chemoattractant to vascular endothelial cells and a chemotaxis inhibitor for leukocytes. Slit2 is expressed primarily in the fetal lung, kidney, and adult spinal cord, and to a lesser extent in adult adrenal gland, thyroid and trachea. Slit2 is initially synthesized as a 1499 amino acid precursor, which is subsequently cleaved into N-terminal and C-terminal fragments, designated as Slit2-N and Slit2-C respectively. The neurodevelopment related activities, as measured by the ability to repel olfactory bulb axons and to induce branching in dorsal root ganglia axons, are contained only in the N-terminal fragment. Recombinant human Slit2-N is a 1093 amino acid glycoprotein corresponding to the N-terminal portion of the full length Slit2 precursor. Due to glycosylation Slit2-N migrates at an apparent molecular weight of approximately 120.0-140.0 kDa by SDS-PAGE analysis under reducing conditions. |
Recombinant Slit Homolog 2 (Slit2) |
4-RPA672Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O94813
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.1kDa
- Isoelectric Point: 6.5
|
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli |
Recombinant Slit Homolog 2 (Slit2) |
4-RPA672Hu02 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O94813
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 14.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli |
Recombinant Slit Homolog 2 (Slit2) |
4-RPA672Mu01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9R1B9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli |
Recombinant Slit Homolog 2 (Slit2) |
4-RPA672Mu02 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9R1B9
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 13.9kDa
- Isoelectric Point: 8.8
|
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli |
Recombinant Slit Homolog 2 (Slit2) |
4-RPA672Ra01 |
Cloud-Clone |
-
EUR 504.99
-
EUR 238.00
-
EUR 1618.72
-
EUR 606.24
-
EUR 1112.48
-
EUR 401.00
-
EUR 3896.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9WVC1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.9kDa
- Isoelectric Point: 6.8
|
Description: Recombinant Rat Slit Homolog 2 expressed in: E.coli |
SLIT2 ELISA Kit (Human) (OKAN05148) |
OKAN05148 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL |
SLIT2 ELISA Kit (Rat) (OKCD02863) |
OKCD02863 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL |
Slit2 ELISA Kit (Mouse) (OKBB01273) |
OKBB01273 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Slit homolog 2 protein is a protein that in humans is encoded by the SLIT2 gene. It is mapped to 5; 5 B3. The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
SLIT2 ELISA Kit (Human) (OKCD06649) |
OKCD06649 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL |
SLIT2 ELISA Kit (Mouse) (OKCD06650) |
OKCD06650 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 32pg/mL |
Slit2 ELISA Kit (Rat) (OKDD00641) |
OKDD00641 |
Aviva Systems Biology |
96 Wells |
EUR 949 |
Description: Description of target: Acts as a ligand for glypican-1, a heparan sulfate proteoglycan; may play a role in neurogenesis and midline development [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL |
SLIT2 ELISA Kit (Rat) (OKEH07160) |
OKEH07160 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.167 ng/mL |
SLIT2 ELISA Kit (Mouse) (OKEH04365) |
OKEH04365 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
Mouse Slit Homolog 2 (Slit2) Protein |
20-abx168430 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Slit Homolog 2 (Slit2) Protein |
20-abx069120 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Slit Homolog 2 (Slit2) Protein |
20-abx069121 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Rat Slit Homolog 2 (Slit2) Protein |
20-abx069122 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2179.00
-
EUR 843.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Slit Homolog 2 (Slit2) Protein |
20-abx069123 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Neuronal Chemorepellent Slit2 ELISA Kit |
CN-02502M1 |
ChemNorm |
96T |
EUR 461 |
Mouse Neuronal Chemorepellent Slit2 ELISA Kit |
CN-02502M2 |
ChemNorm |
48T |
EUR 310 |
Human Neuronal Chemorepellent Slit2 ELISA Kit |
CN-04431H1 |
ChemNorm |
96T |
EUR 458 |
Human Neuronal Chemorepellent Slit2 ELISA Kit |
CN-04431H2 |
ChemNorm |
48T |
EUR 307 |
Slit2 sgRNA CRISPR Lentivector set (Rat) |
K7341301 |
ABM |
3 x 1.0 ug |
EUR 339 |
SLIT2 sgRNA CRISPR Lentivector set (Human) |
K2195701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Slit2 sgRNA CRISPR Lentivector set (Mouse) |
K4000801 |
ABM |
3 x 1.0 ug |
EUR 339 |
SLIT2-IT1 ORF Vector (Human) (pORF) |
ORF032570 |
ABM |
1.0 ug DNA |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
SLIT2 Rabbit Polyclonal Antibody