SLIT2 Rabbit Polyclonal Antibody

SLIT2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

SLIT2 Polyclonal Antibody

ES11862-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SLIT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLIT2 Rabbit pAb

A15353-100ul 100 ul
EUR 308

SLIT2 Rabbit pAb

A15353-200ul 200 ul
EUR 459

SLIT2 Rabbit pAb

A15353-20ul 20 ul
EUR 183

SLIT2 Rabbit pAb

A15353-50ul 50 ul
EUR 223

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-48T 48T
EUR 479
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-96T 96T
EUR 621
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Mu-48T 48T
EUR 489
  • Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Mu-96T 96T
EUR 635
  • Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Ra-48T 48T
EUR 508
  • Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Ra-96T 96T
EUR 661
  • Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-48Tests 48 Tests
EUR 478

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-96Tests 96 Tests
EUR 662

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Mu-48Tests 48 Tests
EUR 489

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Mu-96Tests 96 Tests
EUR 677

Rat Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Ra-48Tests 48 Tests
EUR 511

Rat Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Ra-96Tests 96 Tests
EUR 709

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-48Tests 48 Tests
EUR 500

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-96Tests 96 Tests
EUR 692

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Mu-48Tests 48 Tests
EUR 511

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Mu-96Tests 96 Tests
EUR 709

Rat Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Ra-48Tests 48 Tests
EUR 534

Rat Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Ra-96Tests 96 Tests
EUR 742

Rabbit Slit2 ELISA Kit

ERTS0119 96Tests
EUR 521

Polyclonal SLIT2 Antibody (internal region)

APR13393G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLIT2 (internal region). This antibody is tested and proven to work in the following applications:

SLIT2 antibody

70R-21701 50 ul
EUR 435
Description: Rabbit polyclonal SLIT2 antibody

SLIT2 Antibody

37951-100ul 100ul
EUR 252

SLIT2 Antibody

1-CSB-PA136864
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SLIT2 Antibody

DF7991 200ul
EUR 304
Description: SLIT2 Antibody detects endogenous levels of total SLIT2.

SLIT2 Antibody

1-CSB-PA245341
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SLIT2 Antibody

1-CSB-PA021768GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SLIT2 Antibody

ABD7991 100 ug
EUR 438

Anti-SLIT2 Antibody

A01627 100ug/200ul
EUR 397
Description: Goat Polyclonal SLIT2 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

SLIT2-Specific Antibody

abx237981-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SLIT2 Conjugated Antibody

C37951 100ul
EUR 397

anti- SLIT2 antibody

FNab07981 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: slit homolog 2
  • Uniprot ID: O94813
  • Gene ID: 9353
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
Description: Antibody raised against SLIT2

Anti-SLIT2 antibody

STJ117548 100 µl
EUR 277
Description: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.

Anti-SLIT2 antibody

STJ193020 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SLIT2

Anti-SLIT2 antibody

STJ70945 100 µg
EUR 359

Slit2/ Rat Slit2 ELISA Kit

ELI-02345r 96 Tests
EUR 886

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)

4-PAA672Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)

4-PAA672Hu02
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)

4-PAA672Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)

4-PAA672Mu02
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat)

4-PAA672Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2)

SLIT2 siRNA

20-abx934241
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLIT2 siRNA

20-abx934242
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Slit2, CHO

PR15085 50 ug
EUR 461

anti-Slit2

YF-PA25316 50 ul
EUR 334
Description: Mouse polyclonal to Slit2

Anti-Slit2 Monoclonal Antibody

M01627 100ug
EUR 397
Description: Rabbit Monoclonal Slit2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-SLIT2-Specific antibody

PAab07981 100 ug
EUR 386

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC

4-PAA672Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated

4-PAA672Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3

4-PAA672Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC

4-PAA672Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP

4-PAA672Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE

4-PAA672Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC

4-PAA672Hu02-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated

4-PAA672Hu02-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3

4-PAA672Hu02-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC

4-PAA672Hu02-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP

4-PAA672Hu02-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE

4-PAA672Hu02-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC

4-PAA672Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated

4-PAA672Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3

4-PAA672Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC

4-PAA672Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP

4-PAA672Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE

4-PAA672Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC

4-PAA672Mu02-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated

4-PAA672Mu02-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3

4-PAA672Mu02-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC

4-PAA672Mu02-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP

4-PAA672Mu02-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE

4-PAA672Mu02-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC

4-PAA672Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Biotinylated

4-PAA672Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Cy3

4-PAA672Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), FITC

4-PAA672Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), HRP

4-PAA672Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), PE

4-PAA672Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Rabbit Slit Homolog 2 (Slit2) ELISA Kit

abx362683-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Slit Homolog 2 (SLIT2) Antibody

20-abx214142
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101381
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101382
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101383
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101384
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx129328
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx174568
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Slit Homolog 2 (Slit2) Antibody

20-abx174569
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Slit Homolog 2 (SLIT2) Antibody

20-abx242002
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slit Homolog 2 (SLIT2) Antibody

abx431593-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SLIT2 Blocking Peptide

DF7991-BP 1mg
EUR 195

SLIT2 cloning plasmid

CSB-CL021768HU-10ug 10ug
EUR 1790
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4590
  • Sequence: atgcgcggcgttggctggcagatgctgtccctgtcgctggggttagtgctggcgatcctgaacaaggtggcaccgcaggcgtgcccggcgcagtgctcttgctcgggcagcacagtggactgtcacgggctggcgctgcgcagcgtgcccaggaatatcccccgcaacaccgaga
  • Show more
Description: A cloning plasmid for the SLIT2 gene.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7

4-PAA672Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7

4-PAA672Hu02-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA672Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA672Mu02-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC-Cy7

4-PAA672Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 Protein (SLIT2) Antibody

20-abx115592
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)

20-abx272026
  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)

20-abx272728
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)

20-abx273202
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Slit2 ELISA Kit

201-12-0662 96 tests
EUR 440
  • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human SLIT2 ELISA Kit

ELA-E0672h 96 Tests
EUR 824

Human Slit2 ELISA Kit

EHS0119 96Tests
EUR 521

Bovine Slit2 ELISA Kit

EBS0119 96Tests
EUR 521

Anserini Slit2 ELISA Kit

EAS0119 96Tests
EUR 521

Chicken Slit2 ELISA Kit

ECKS0119 96Tests
EUR 521

Canine Slit2 ELISA Kit

ECS0119 96Tests
EUR 521

Goat Slit2 ELISA Kit

EGTS0119 96Tests
EUR 521

SLIT2 ELISA KIT|Human

EF000688 96 Tests
EUR 689

Human Slit2 ELISA Kit

CSB-E11038h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Slit2 ELISA Kit

1-CSB-E11038h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Slit2 ELISA Kit

CSB-E11039m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Slit2 ELISA Kit

1-CSB-E11039m
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse SLIT2 shRNA Plasmid

20-abx972767
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLIT2 shRNA Plasmid

20-abx956191
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine Slit2 ELISA Kit

EPS0119 96Tests
EUR 521

Sheep Slit2 ELISA Kit

ESS0119 96Tests
EUR 521

Mouse Slit2 ELISA Kit        

GA-E0154MS-48T 48T
EUR 336

Mouse Slit2 ELISA Kit        

GA-E0154MS-96T 96T
EUR 534

Rat Slit2 ELISA Kit

ERS0119 96Tests
EUR 521

Monkey Slit2 ELISA Kit

EMKS0119 96Tests
EUR 521

Mouse Slit2 ELISA Kit

EMS0119 96Tests
EUR 521

Active Slit Homolog 2 (Slit2)

4-APA672Ra01
  • EUR 829.34
  • EUR 325.00
  • EUR 2835.04
  • EUR 1011.68
  • EUR 1923.36
  • EUR 618.00
  • EUR 6937.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVC1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: 6.8
Description: Recombinant Rat Slit Homolog 2 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Mouse SLIT2 PicoKine ELISA Kit

EK1860 96 wells
EUR 425
Description: For quantitative detection of mouse SLIT2 in cell culture supernates, serum and plasma (heparin, EDTA).

Guinea Pig Slit2 ELISA Kit

EGS0119 96Tests
EUR 521

Slit2 ORF Vector (Rat) (pORF)

ORF076650 1.0 ug DNA
EUR 2080

SLIT2 ORF Vector (Human) (pORF)

ORF014521 1.0 ug DNA
EUR 95

Slit2 ORF Vector (Mouse) (pORF)

ORF057900 1.0 ug DNA
EUR 1572

Recombinant Human Slit2-N Protein

PROTO94813 25ug
EUR 317
Description: Slit2 is a member of the Slit family that signals through the Roundabout (Robo) receptor as a repellent for axon guidance and neuronal migration, and can also act as a chemoattractant to vascular endothelial cells and a chemotaxis inhibitor for leukocytes. Slit2 is expressed primarily in the fetal lung, kidney, and adult spinal cord, and to a lesser extent in adult adrenal gland, thyroid and trachea. Slit2 is initially synthesized as a 1499 amino acid precursor, which is subsequently cleaved into N-terminal and C-terminal fragments, designated as Slit2-N and Slit2-C respectively. The neurodevelopment related activities, as measured by the ability to repel olfactory bulb axons and to induce branching in dorsal root ganglia axons, are contained only in the N-terminal fragment. Recombinant human Slit2-N is a 1093 amino acid glycoprotein corresponding to the N-terminal portion of the full length Slit2 precursor. Due to glycosylation Slit2-N migrates at an apparent molecular weight of approximately 120.0-140.0 kDa by SDS-PAGE analysis under reducing conditions.

Recombinant Slit Homolog 2 (Slit2)

4-RPA672Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94813
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.1kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)

4-RPA672Hu02
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94813
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)

4-RPA672Mu01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R1B9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)

4-RPA672Mu02
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9R1B9
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.9kDa
  • Isoelectric Point: 8.8
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)

4-RPA672Ra01
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9WVC1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.9kDa
  • Isoelectric Point: 6.8
Description: Recombinant Rat Slit Homolog 2 expressed in: E.coli

pECMV-Slit2-m-FLAG Plasmid

PVT15694 2 ug
EUR 325

SLIT2 ELISA Kit (Human) (OKAN05148)

OKAN05148 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL

SLIT2 ELISA Kit (Rat) (OKCD02863)

OKCD02863 96 Wells
EUR 818
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL

Slit2 ELISA Kit (Mouse) (OKBB01273)

OKBB01273 96 Wells
EUR 505
Description: Description of target: Slit homolog 2 protein is a protein that in humans is encoded by the SLIT2 gene. It is mapped to 5; 5 B3. The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

SLIT2 ELISA Kit (Human) (OKCD06649)

OKCD06649 96 Wells
EUR 753
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL

SLIT2 ELISA Kit (Mouse) (OKCD06650)

OKCD06650 96 Wells
EUR 779
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 32pg/mL

Slit2 ELISA Kit (Rat) (OKDD00641)

OKDD00641 96 Wells
EUR 949
Description: Description of target: Acts as a ligand for glypican-1, a heparan sulfate proteoglycan; may play a role in neurogenesis and midline development [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL

SLIT2 ELISA Kit (Mouse) (OKEH04365)

OKEH04365 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

SLIT2 ELISA Kit (Rat) (OKEH07160)

OKEH07160 96 Wells
EUR 662
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.167 ng/mL

Mouse Slit Homolog 2 (Slit2) Protein

20-abx168430
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Slit Homolog 2 (Slit2) Protein

20-abx069120
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Slit Homolog 2 (Slit2) Protein

20-abx069121
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Slit Homolog 2 (Slit2) Protein

20-abx069122
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Slit Homolog 2 (Slit2) Protein

20-abx069123
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Neuronal Chemorepellent Slit2 ELISA Kit

CN-02502M1 96T
EUR 461

Mouse Neuronal Chemorepellent Slit2 ELISA Kit

CN-02502M2 48T
EUR 310

Human Neuronal Chemorepellent Slit2 ELISA Kit

CN-04431H1 96T
EUR 458

Human Neuronal Chemorepellent Slit2 ELISA Kit

CN-04431H2 48T
EUR 307

Slit2 sgRNA CRISPR Lentivector set (Rat)

K7341301 3 x 1.0 ug
EUR 339

SLIT2 sgRNA CRISPR Lentivector set (Human)

K2195701 3 x 1.0 ug
EUR 339

Slit2 sgRNA CRISPR Lentivector set (Mouse)

K4000801 3 x 1.0 ug
EUR 339

SLIT2-IT1 ORF Vector (Human) (pORF)

ORF032570 1.0 ug DNA Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

SLIT2 Rabbit Polyclonal Antibody