SLIT2 Rabbit Polyclonal Antibody

SLIT2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

SLIT2 Polyclonal Antibody

ES11862-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SLIT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SLIT2 Rabbit pAb

A15353-100ul 100 ul
EUR 308

SLIT2 Rabbit pAb

A15353-200ul 200 ul
EUR 459

SLIT2 Rabbit pAb

A15353-20ul 20 ul
EUR 183

SLIT2 Rabbit pAb

A15353-50ul 50 ul
EUR 223

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-48T 48T
EUR 479
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-96T 96T
EUR 621
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Mu-48T 48T
EUR 489
  • Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Mu-96T 96T
EUR 635
  • Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Ra-48T 48T
EUR 508
  • Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Ra-96T 96T
EUR 661
  • Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-48Tests 48 Tests
EUR 478

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-96Tests 96 Tests
EUR 662

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Mu-48Tests 48 Tests
EUR 489

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Mu-96Tests 96 Tests
EUR 677

Rat Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Ra-48Tests 48 Tests
EUR 511

Rat Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Ra-96Tests 96 Tests
EUR 709

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-48Tests 48 Tests
EUR 500

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-96Tests 96 Tests
EUR 692

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Mu-48Tests 48 Tests
EUR 511

Mouse Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Mu-96Tests 96 Tests
EUR 709

Rat Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Ra-48Tests 48 Tests
EUR 534

Rat Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Ra-96Tests 96 Tests
EUR 742

Rabbit Slit2 ELISA Kit

ERTS0119 96Tests
EUR 521

Polyclonal SLIT2 Antibody (internal region)

APR13393G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLIT2 (internal region). This antibody is tested and proven to work in the following applications:

SLIT2 antibody

70R-21701 50 ul
EUR 435
Description: Rabbit polyclonal SLIT2 antibody

SLIT2 Antibody

37951-100ul 100ul
EUR 252

SLIT2 Antibody

1-CSB-PA136864
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SLIT2 Antibody

DF7991 200ul
EUR 304
Description: SLIT2 Antibody detects endogenous levels of total SLIT2.

SLIT2 Antibody

1-CSB-PA245341
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SLIT2 Antibody

1-CSB-PA021768GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SLIT2 Antibody

ABD7991 100 ug
EUR 438

Anti-SLIT2 Antibody

A01627 100ug/200ul
EUR 397
Description: Goat Polyclonal SLIT2 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

SLIT2-Specific Antibody

abx237981-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SLIT2 Conjugated Antibody

C37951 100ul
EUR 397

anti- SLIT2 antibody

FNab07981 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: slit homolog 2
  • Uniprot ID: O94813
  • Gene ID: 9353
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
Description: Antibody raised against SLIT2

Anti-SLIT2 antibody

STJ117548 100 µl
EUR 277
Description: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.

Anti-SLIT2 antibody

STJ193020 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SLIT2

Anti-SLIT2 antibody

STJ70945 100 µg
EUR 359

Slit2/ Rat Slit2 ELISA Kit

ELI-02345r 96 Tests
EUR 886

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)

4-PAA672Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)

4-PAA672Hu02
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)

4-PAA672Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)

4-PAA672Mu02
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat)

4-PAA672Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2)

SLIT2 siRNA

20-abx934241
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SLIT2 siRNA

20-abx934242
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Slit2, CHO

PR15085 50 ug
EUR 461

anti-Slit2

YF-PA25316 50 ul
EUR 334
Description: Mouse polyclonal to Slit2

Anti-Slit2 Monoclonal Antibody

M01627 100ug
EUR 397
Description: Rabbit Monoclonal Slit2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-SLIT2-Specific antibody

PAab07981 100 ug
EUR 386

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC

4-PAA672Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated

4-PAA672Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3

4-PAA672Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC

4-PAA672Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP

4-PAA672Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE

4-PAA672Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC

4-PAA672Hu02-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated

4-PAA672Hu02-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3

4-PAA672Hu02-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC

4-PAA672Hu02-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP

4-PAA672Hu02-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE

4-PAA672Hu02-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC

4-PAA672Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated

4-PAA672Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3

4-PAA672Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC

4-PAA672Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP

4-PAA672Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE

4-PAA672Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Gln31~His197)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC

4-PAA672Mu02-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated

4-PAA672Mu02-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3

4-PAA672Mu02-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC

4-PAA672Mu02-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP

4-PAA672Mu02-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE

4-PAA672Mu02-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1408~Cys1519)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC

4-PAA672Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Biotinylated

4-PAA672Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Cy3

4-PAA672Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), FITC

4-PAA672Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), HRP

4-PAA672Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), PE

4-PAA672Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Asn209~Gly374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Rabbit Slit Homolog 2 (Slit2) ELISA Kit

abx362683-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Slit Homolog 2 (SLIT2) Antibody

20-abx214142
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101381
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101382
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101383
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx101384
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx129328
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody

20-abx174568
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Slit Homolog 2 (Slit2) Antibody

20-abx174569
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Slit Homolog 2 (SLIT2) Antibody

20-abx242002
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Slit Homolog 2 (SLIT2) Antibody

abx431593-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SLIT2 Blocking Peptide

DF7991-BP 1mg
EUR 195

SLIT2 cloning plasmid

CSB-CL021768HU-10ug 10ug
EUR 1790
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4590
  • Sequence: atgcgcggcgttggctggcagatgctgtccctgtcgctggggttagtgctggcgatcctgaacaaggtggcaccgcaggcgtgcccggcgcagtgctcttgctcgggcagcacagtggactgtcacgggctggcgctgcgcagcgtgcccaggaatatcccccgcaacaccgaga
  • Show more
Description: A cloning plasmid for the SLIT2 gene.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7

4-PAA672Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Val1160~Cys1333)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7

4-PAA672Hu02-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Slit2 (Cys1416~Val1528)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

SLIT2 Rabbit Polyclonal Antibody