SLIT2 Rabbit Polyclonal Antibody

SLIT2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

SLIT2 Polyclonal Antibody
ABP60432-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SLIT2 protein Applications tips:
Description: A polyclonal antibody for detection of SLIT2 from Human, Mouse. This SLIT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SLIT2 protein

SLIT2 Rabbit pAb
A15353-100ul	Abclonal	100 ul	EUR 308

SLIT2 Rabbit pAb
A15353-200ul	Abclonal	200 ul	EUR 459

SLIT2 Rabbit pAb
A15353-20ul	Abclonal	20 ul	EUR 183

SLIT2 Rabbit pAb
A15353-50ul	Abclonal	50 ul	EUR 223

Human Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Hu-48T	DL Develop	48T	EUR 479
Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Hu-96T	DL Develop	96T	EUR 621
Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Slit Homolog 2 (Slit2) ELISA Kit
DLR-Slit2-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Slit Homolog 2 (Slit2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Slit Homolog 2 (Slit2) ELISA Kit
RD-Slit2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Slit Homolog 2 (Slit2) ELISA Kit
RDR-Slit2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Polyclonal SLIT2 Antibody (internal region)
APR13393G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SLIT2 (internal region). This antibody is tested and proven to work in the following applications:

Rabbit Slit2 ELISA Kit
ERTS0119	Abclonal	96Tests	EUR 521

SLIT2 antibody
70R-21701	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SLIT2 antibody

SLIT2 Antibody
ABD7991	Lifescience Market	100 ug	EUR 438

SLIT2 Antibody
37951-100ul	SAB	100ul	EUR 252

SLIT2 Antibody
DF7991	Affbiotech	200ul	EUR 304
Description: SLIT2 Antibody detects endogenous levels of total SLIT2.

SLIT2 Antibody
1-CSB-PA245341	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SLIT2 Antibody
1-CSB-PA136864	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SLIT2 Antibody
1-CSB-PA021768GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLIT2. Recognizes SLIT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SLIT2 Conjugated Antibody
C37951	SAB	100ul	EUR 397

anti- SLIT2 antibody
FNab07981	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: slit homolog 2 Uniprot ID: O94813 Gene ID: 9353 Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience
Description: Antibody raised against SLIT2

SLIT2-Specific Antibody
abx237981-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-SLIT2 Antibody
A01627	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal SLIT2 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-SLIT2 antibody
STJ70945	St John's Laboratory	100 µg	EUR 359

Anti-SLIT2 antibody
STJ117548	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.

Anti-SLIT2 antibody
STJ193020	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SLIT2

Slit2/ Rat Slit2 ELISA Kit
ELI-02345r	Lifescience Market	96 Tests	EUR 886

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)
4-PAA672Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human)
4-PAA672Hu02	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)
4-PAA672Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse)
4-PAA672Mu02	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2)

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat)
4-PAA672Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2)

SLIT2 siRNA
20-abx934241	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLIT2 siRNA
20-abx934242	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Slit2, CHO
PR15085	Neuromics	50 ug	EUR 461

anti-Slit2
YF-PA25316	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Slit2

Anti-SLIT2-Specific antibody
PAab07981	Lifescience Market	100 ug	EUR 386

Anti-Slit2 Monoclonal Antibody
M01627	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal Slit2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC
4-PAA672Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated
4-PAA672Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3
4-PAA672Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC
4-PAA672Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP
4-PAA672Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE
4-PAA672Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC
4-PAA672Hu02-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Biotinylated
4-PAA672Hu02-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), Cy3
4-PAA672Hu02-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), FITC
4-PAA672Hu02-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), HRP
4-PAA672Hu02-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), PE
4-PAA672Hu02-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC
4-PAA672Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA672Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3
4-PAA672Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC
4-PAA672Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP
4-PAA672Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE
4-PAA672Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC
4-PAA672Mu02-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA672Mu02-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), Cy3
4-PAA672Mu02-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), FITC
4-PAA672Mu02-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), HRP
4-PAA672Mu02-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), PE
4-PAA672Mu02-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC
4-PAA672Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Biotinylated
4-PAA672Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Biotin.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), Cy3
4-PAA672Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with Cy3.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), FITC
4-PAA672Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with FITC.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), HRP
4-PAA672Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with HRP.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), PE
4-PAA672Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with PE.

Rabbit Slit Homolog 2 (Slit2) ELISA Kit
abx362683-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx129328	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx101381	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx101382	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx101383	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx101384	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Slit Homolog 2 (Slit2) Antibody
20-abx174568	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Slit Homolog 2 (Slit2) Antibody
20-abx174569	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Slit Homolog 2 (SLIT2) Antibody
20-abx214142	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Slit Homolog 2 (SLIT2) Antibody
abx431593-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Slit Homolog 2 (SLIT2) Antibody
20-abx242002	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

SLIT2 cloning plasmid
CSB-CL021768HU-10ug	Cusabio	10ug	EUR 1790
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4590 Sequence: atgcgcggcgttggctggcagatgctgtccctgtcgctggggttagtgctggcgatcctgaacaaggtggcaccgcaggcgtgcccggcgcagtgctcttgctcgggcagcacagtggactgtcacgggctggcgctgcgcagcgtgcccaggaatatcccccgcaacaccgaga Show more
Description: A cloning plasmid for the SLIT2 gene.

SLIT2 Blocking Peptide
DF7991-BP	Affbiotech	1mg	EUR 195

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7
4-PAA672Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Val1160~Cys1333) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Human), APC-Cy7
4-PAA672Hu02-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1416~Val1528) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA672Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Gln31~His197) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA672Mu02-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Cys1408~Cys1519) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 (Slit2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA672Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Slit2 (Asn209~Gly374) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Slit Homolog 2 (Slit2). This antibody is labeled with APC-Cy7.

Slit Homolog 2 Protein (SLIT2) Antibody
20-abx115592	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)
20-abx272026	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)
20-abx272728	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Slit Homolog 2 (Slit2) Antibody (Biotin)
20-abx273202	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Slit2 ELISA Kit
EHS0119	Abclonal	96Tests	EUR 521

Human SLIT2 ELISA Kit
ELA-E0672h	Lifescience Market	96 Tests	EUR 824

Goat Slit2 ELISA Kit
EGTS0119	Abclonal	96Tests	EUR 521

Bovine Slit2 ELISA Kit
EBS0119	Abclonal	96Tests	EUR 521

Chicken Slit2 ELISA Kit
ECKS0119	Abclonal	96Tests	EUR 521

Anserini Slit2 ELISA Kit
EAS0119	Abclonal	96Tests	EUR 521

Canine Slit2 ELISA Kit
ECS0119	Abclonal	96Tests	EUR 521

SLIT2 ELISA KIT|Human
EF000688	Lifescience Market	96 Tests	EUR 689

Mouse Slit2 ELISA Kit
GA-E0154MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Slit2 ELISA Kit
GA-E0154MS-96T	GenAsia Biotech	96T	EUR 534

Porcine Slit2 ELISA Kit
EPS0119	Abclonal	96Tests	EUR 521

Rat Slit2 ELISA Kit
ERS0119	Abclonal	96Tests	EUR 521

Sheep Slit2 ELISA Kit
ESS0119	Abclonal	96Tests	EUR 521

Monkey Slit2 ELISA Kit
EMKS0119	Abclonal	96Tests	EUR 521

Mouse Slit2 ELISA Kit
EMS0119	Abclonal	96Tests	EUR 521

Human SLIT2 shRNA Plasmid
20-abx956191	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Slit2 ELISA Kit
201-12-0662	SunredBio	96 tests	EUR 440
This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse SLIT2 shRNA Plasmid
20-abx972767	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Slit2 ELISA Kit
CSB-E11038h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Slit2 ELISA Kit
1-CSB-E11038h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Slit2 ELISA Kit
CSB-E11039m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Slit2 ELISA Kit
1-CSB-E11039m	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Slit2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Active Slit Homolog 2 (Slit2)
4-APA672Ra01	Cloud-Clone	EUR 829.34 EUR 325.00 EUR 2835.04 EUR 1011.68 EUR 1923.36 EUR 618.00 EUR 6937.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9WVC1 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.9kDa Isoelectric Point: 6.8
Description: Recombinant Rat Slit Homolog 2 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Mouse SLIT2 PicoKine ELISA Kit
EK1860	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse SLIT2 in cell culture supernates, serum and plasma (heparin, EDTA).

Guinea Pig Slit2 ELISA Kit
EGS0119	Abclonal	96Tests	EUR 521

Recombinant Human Slit2-N Protein
PROTO94813	BosterBio	25ug	EUR 317
Description: Slit2 is a member of the Slit family that signals through the Roundabout (Robo) receptor as a repellent for axon guidance and neuronal migration, and can also act as a chemoattractant to vascular endothelial cells and a chemotaxis inhibitor for leukocytes. Slit2 is expressed primarily in the fetal lung, kidney, and adult spinal cord, and to a lesser extent in adult adrenal gland, thyroid and trachea. Slit2 is initially synthesized as a 1499 amino acid precursor, which is subsequently cleaved into N-terminal and C-terminal fragments, designated as Slit2-N and Slit2-C respectively. The neurodevelopment related activities, as measured by the ability to repel olfactory bulb axons and to induce branching in dorsal root ganglia axons, are contained only in the N-terminal fragment. Recombinant human Slit2-N is a 1093 amino acid glycoprotein corresponding to the N-terminal portion of the full length Slit2 precursor. Due to glycosylation Slit2-N migrates at an apparent molecular weight of approximately 120.0-140.0 kDa by SDS-PAGE analysis under reducing conditions.

Slit2 ORF Vector (Mouse) (pORF)
ORF057900	ABM	1.0 ug DNA	EUR 1572

Slit2 ORF Vector (Rat) (pORF)
ORF076650	ABM	1.0 ug DNA	EUR 2080

SLIT2 ORF Vector (Human) (pORF)
ORF014521	ABM	1.0 ug DNA	EUR 95

Recombinant Slit Homolog 2 (Slit2)
4-RPA672Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O94813 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.1kDa Isoelectric Point: 6.5
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)
4-RPA672Hu02	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O94813 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)
4-RPA672Mu01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9R1B9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.6kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)
4-RPA672Mu02	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9R1B9 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 13.9kDa Isoelectric Point: 8.8
Description: Recombinant Mouse Slit Homolog 2 expressed in: E.coli

Recombinant Slit Homolog 2 (Slit2)
4-RPA672Ra01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9WVC1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.9kDa Isoelectric Point: 6.8
Description: Recombinant Rat Slit Homolog 2 expressed in: E.coli

pECMV-Slit2-m-FLAG Plasmid
PVT15694	Lifescience Market	2 ug	EUR 325

SLIT2 ELISA Kit (Human) (OKAN05148)
OKAN05148	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.59 ng/mL

SLIT2 ELISA Kit (Rat) (OKCD02863)
OKCD02863	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 30 pg/mL

SLIT2 ELISA Kit (Human) (OKCD06649)
OKCD06649	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL

SLIT2 ELISA Kit (Mouse) (OKCD06650)
OKCD06650	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 32pg/mL

Slit2 ELISA Kit (Rat) (OKDD00641)
OKDD00641	Aviva Systems Biology	96 Wells	EUR 949
Description: Description of target: Acts as a ligand for glypican-1, a heparan sulfate proteoglycan; may play a role in neurogenesis and midline development [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.053 ng/mL

SLIT2 ELISA Kit (Mouse) (OKEH04365)
OKEH04365	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

Slit2 ELISA Kit (Mouse) (OKBB01273)
OKBB01273	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Slit homolog 2 protein is a protein that in humans is encoded by the SLIT2 gene. It is mapped to 5; 5 B3. The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

SLIT2 ELISA Kit (Rat) (OKEH07160)
OKEH07160	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth-stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post-crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. Seems to be involved in regulating leukocyte migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.167 ng/mL

Human Slit Homolog 2 (Slit2) Protein
20-abx069120	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Slit Homolog 2 (Slit2) Protein
20-abx069121	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Slit Homolog 2 (Slit2) Protein
20-abx069122	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Slit Homolog 2 (Slit2) Protein
20-abx069123	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Slit Homolog 2 (Slit2) Protein
20-abx168430	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

SLIT2 sgRNA CRISPR Lentivector set (Human)
K2195701	ABM	3 x 1.0 ug	EUR 339

Mouse Neuronal Chemorepellent Slit2 ELISA Kit
CN-02502M1	ChemNorm	96T	EUR 461

Mouse Neuronal Chemorepellent Slit2 ELISA Kit
CN-02502M2	ChemNorm	48T	EUR 310

Human Neuronal Chemorepellent Slit2 ELISA Kit
CN-04431H1	ChemNorm	96T	EUR 458

Human Neuronal Chemorepellent Slit2 ELISA Kit
CN-04431H2	ChemNorm	48T	EUR 307

Slit2 sgRNA CRISPR Lentivector set (Mouse)
K4000801	ABM	3 x 1.0 ug	EUR 339

Slit2 sgRNA CRISPR Lentivector set (Rat)
K7341301	ABM	3 x 1.0 ug	EUR 339

SLIT2-IT1 ORF Vector (Human) (pORF)
ORF032570	ABM	1.0 ug DNA	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SLIT2 Rabbit Polyclonal Antibody