TSHR Rabbit Polyclonal Antibody

TSHR Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TSHR Polyclonal Antibody
ABP60783-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360

TSHR Polyclonal Antibody
ABP60783-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360

TSHR Polyclonal Antibody
ABP60783-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of TSHR from Human, Mouse, Rat. This TSHR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TSHR protein at amino acid sequence of 280-360

TSHR Polyclonal Antibody
ES11649-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHR Polyclonal Antibody
ES11649-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TSHR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

TSHR Rabbit pAb
A1012-100ul	Abclonal	100 ul	EUR 308

TSHR Rabbit pAb
A1012-200ul	Abclonal	200 ul	EUR 459

TSHR Rabbit pAb
A1012-20ul	Abclonal	20 ul	Ask for price

TSHR Rabbit pAb
A1012-50ul	Abclonal	50 ul	Ask for price

TSHR Rabbit pAb
A6781-100ul	Abclonal	100 ul	EUR 308

TSHR Rabbit pAb
A6781-200ul	Abclonal	200 ul	EUR 459

TSHR Rabbit pAb
A6781-20ul	Abclonal	20 ul	EUR 183

TSHR Rabbit pAb
A6781-50ul	Abclonal	50 ul	EUR 223

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-48T	DL Develop	48T	EUR 517
Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Hu-96T	DL Develop	96T	EUR 673
Should the Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
DLR-TSHR-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thyroid Stimulating Hormone Receptor (TSHR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RDR-TSHR-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Thyroid Stimulating Hormone Receptor (TSHR) ELISA Kit
RD-TSHR-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

TSHR Polyclonal Antibody, Biotin Conjugated
A53711	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TSHR Polyclonal Antibody, FITC Conjugated
A53712	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TSHR Polyclonal Antibody, HRP Conjugated
A53713	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TSHR antibody
70R-1187	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR antibody
70R-21027	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TSHR antibody

TSHR antibody
70R-2915	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the C terminal of TSHR

TSHR Antibody
35980-100ul	SAB	100ul	EUR 252

TSHR antibody
39177-100ul	SAB	100ul	EUR 252

TSHR Antibody
1-CSB-PA11189A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

TSHR Antibody
1-CSB-PA973863	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TSHR Antibody
1-CSB-PA820027	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TSHR Antibody
DF12492	Affbiotech	200ul	EUR 304
Description: TSHR antibody detects endogenous levels of TSHR.

TSHR antibody
70R-5997	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR antibody
70R-6004	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TSHR antibody raised against the N terminal of TSHR

TSHR Antibody
1-CSB-PA025131GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TSHR Conjugated Antibody
C35980	SAB	100ul	EUR 397

anti- TSHR antibody
FNab09045	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:20- 1:50 Immunogen: thyroid stimulating hormone receptor Uniprot ID: P16473 Gene ID: 7253 Research Area: Cancer, Signal Transduction
Description: Antibody raised against TSHR

Anti-TSHR antibody
PAab09045	Lifescience Market	100 ug	EUR 386

Anti-TSHR antibody
STJ25983	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.

Anti-TSHR antibody
STJ28864	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.

Anti-TSHR antibody
STJ192807	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TSHR

Tshr/ Rat Tshr ELISA Kit
ELI-16646r	Lifescience Market	96 Tests	EUR 886

Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13833G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSH Receptor / TSHR Antibody (C-Terminus)
APR13834G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSH Receptor / TSHR Antibody (N-Terminus)
APR13835G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSH Receptor / TSHR (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TSHR (aa101-115) Antibody (internal region)
APR13836G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TSHR (aa101-115) (internal region). This antibody is tested and proven to work in the following applications:

TSHR siRNA
20-abx905828	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSHR siRNA
20-abx938292	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TSHR siRNA
20-abx938293	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-TSHR
PVT18095	Lifescience Market	2 ug	EUR 231

TSHR Antibody, HRP conjugated
1-CSB-PA11189B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSHR Antibody, FITC conjugated
1-CSB-PA11189C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSHR Antibody, Biotin conjugated
1-CSB-PA11189D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSHR. Recognizes TSHR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Thyrotropin Receptor (TSHR) Antibody
20-abx005203	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Thyrotropin Receptor (TSHR) Antibody
20-abx142283	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Thyrotropin Receptor (TSHR) Antibody
abx239045-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thyrotropin Receptor (TSHR) Antibody
abx412917-02mg	Abbexa	0.2 mg	EUR 648
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx413193-02mg	Abbexa	0.2 mg	EUR 648
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx413194-20ug	Abbexa	20 ug	EUR 300
Shipped within 1 week.

Thyrotropin Receptor (TSHR) Antibody
abx433417-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Thyrotropin Receptor (TSHR) Antibody
20-abx000958	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat)
4-PAC825Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR)

TSHR Blocking Peptide
33R-2549	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-6004

TSHR Blocking Peptide
33R-4502	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-2915

TSHR Blocking Peptide
33R-5481	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-5997

TSHR Blocking Peptide
33R-1711	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSHR antibody, catalog no. 70R-1187

TSHR Blocking Peptide
DF12492-BP	Affbiotech	1mg	EUR 195

TSHR 420 Protein
20-abx060300	Abbexa	EUR 495.00 EUR 1595.00	100 ug 1 mg
Shipped within 5-10 working days.

TSHR cloning plasmid
CSB-CL025131HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct Show more
Description: A cloning plasmid for the TSHR gene.

TSHR cloning plasmid
CSB-CL025131HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atgaggccggcggacttgctgcagctggtgctgctgctcgacctgcccagggacctgggcggaatggggtgttcgtctccaccctgcgagtgccatcaggaggaggacttcagagtcacctgcaaggatattcaacgcatccccagcttaccgcccagtacgcagactctgaagct Show more
Description: A cloning plasmid for the TSHR gene.

Recombinant Human TSHR
P0062	FN Test	100ug	EUR 522.36
Formulation: More than 95% by SDS-PAGE gel analyses Reconstitution: Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose, pH7.4 Purity: Thyroid-stimulating hormone receptor,TSH-R,LGR3 Uniprot ID: P16473
Description: Recombinant Human protein for TSHR

Anti-TSH Receptor/TSHR Antibody
A00576-1	BosterBio	100ug/vial	EUR 294

Anti-TSH Receptor/TSHR Antibody
PA2013	BosterBio	100ug/vial	EUR 334

Anti-TSHR (aa101-115) antibody
STJ72663	St John's Laboratory	100 µg	EUR 359

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC
4-PAC825Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Biotinylated
4-PAC825Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Biotin.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), Cy3
4-PAC825Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with Cy3.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), FITC
4-PAC825Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with FITC.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), HRP
4-PAC825Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with HRP.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), PE
4-PAC825Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with PE.

Thyroid Stimulating Hormone Receptor (TSHR) Polyclonal Antibody (Rat), APC-Cy7
4-PAC825Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TSHR (Pro28~Gly245) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thyroid Stimulating Hormone Receptor (TSHR). This antibody is labeled with APC-Cy7.

Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210603	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thyroid-Stimulating Hormone Receptor (TSHR) Antibody
20-abx210604	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx130083	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thyroid Stimulating Hormone Receptor (TSHR) Antibody
20-abx174793	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Canine TSHR ELISA KIT
ELI-16645d	Lifescience Market	96 Tests	EUR 928

Human TSHR ELISA Kit
ELA-E9855h	Lifescience Market	96 Tests	EUR 824

TSHR ELISA KIT|Human
EF006552	Lifescience Market	96 Tests	EUR 689

Mouse TSHR shRNA Plasmid
20-abx973235	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TSHR shRNA Plasmid
20-abx984958	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TSHR shRNA Plasmid
20-abx954957	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TSHR Recombinant Protein (Rat)
RP234971	ABM	100 ug	Ask for price

TSHR Recombinant Protein (Human)
RP033142	ABM	100 ug	Ask for price

TSHR Recombinant Protein (Human)
RP033145	ABM	100 ug	Ask for price

TSHR Recombinant Protein (Mouse)
RP181712	ABM	100 ug	Ask for price

TSHR Recombinant Protein (Mouse)
RP181715	ABM	100 ug	Ask for price

Tshr ORF Vector (Rat) (pORF)
ORF078325	ABM	1.0 ug DNA	EUR 506

h TSHR inducible lentiviral particles
LVP510	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: TSHR (alternative name: CHNG1, LGR3, hTSHR-I). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000369.2. Particles also contains a RFP-Blasticidin dual selection marker.

TSHR ORF Vector (Human) (pORF)
ORF011048	ABM	1.0 ug DNA	EUR 95

TSHR ORF Vector (Human) (pORF)
ORF011049	ABM	1.0 ug DNA	EUR 95

Tshr ORF Vector (Mouse) (pORF)
ORF060572	ABM	1.0 ug DNA	EUR 506

Tshr ORF Vector (Mouse) (pORF)
ORF060573	ABM	1.0 ug DNA	EUR 506

pECMV-Tshr-m-FLAG Plasmid
PVT15360	Lifescience Market	2 ug	EUR 325

TSHR Western Blot kit (AWBK41870)
AWBK41870	Aviva Systems Biology	10 reactions	EUR 647
Description: Description of target: Species reactivity: Application: Assay info: Sensitivity:

TSHR ELISA Kit (Rat) (OKCD02953)
OKCD02953	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Receptor for thyrothropin. Plays a central role in controlling thyroid cell metabolism. The activity of this receptor is mediated by G proteins which activate adenylate cyclase. Also acts as a receptor for thyrostimulin (GPA2+GPB5). ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL

TSHR ELISA Kit (Dog) (OKEH08816)
OKEH08816	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

TSHR ELISA Kit (Mouse) (OKEH04953)
OKEH04953	Aviva Systems Biology	96 Wells	EUR 870
Description: Description of target: Receptor for thyrothropin. Plays a central role in controlling thyroid cell metabolism. The activity of this receptor is mediated by G proteins which activate adenylate cyclase. Also acts as a receptor for thyrostimulin (GPA2+GPB5). ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Human TSHR(Thyrotropin receptor) ELISA Kit
EH2520	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: P16473 Alias: TSHR/CHNG1/LGR3/CHNG1/LGR3hTSHR-I/seven transmembrane helix receptor/thyroid stimulating hormone receptor/Thyroid-stimulating hormone receptor/thyrotropin receptor/thyrotropin receptor-I, hTS Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Rat Tshr/ Thyrotropin receptor ELISA Kit
E1013Ra	Sunlong	1 Kit	EUR 646

Mouse Tshr/ Thyrotropin receptor ELISA Kit
E1535Mo	Sunlong	1 Kit	EUR 632

Human TSHR/ Thyrotropin receptor ELISA Kit
E2600Hu	Sunlong	1 Kit	EUR 605

Bovine Thyrotropin receptor, TSHR ELISA KIT
ELI-16644b	Lifescience Market	96 Tests	EUR 928

Human Thyrotropin receptor, TSHR ELISA KIT
ELI-45740h	Lifescience Market	96 Tests	EUR 824

Cow Thyrotropin receptor (TSHR) ELISA Kit
abx521354-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Thyrotropin receptor (TSHR) ELISA Kit
abx521355-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Thyrotropin receptor (TSHR) ELISA Kit
abx521356-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Thyrotropin receptor (TSHR) ELISA Kit
abx521357-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Pig Thyrotropin receptor (TSHR) ELISA Kit
abx521358-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Thyrotropin receptor (TSHR) ELISA Kit
abx521359-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Tshr sgRNA CRISPR Lentivector set (Mouse)
K4871001	ABM	3 x 1.0 ug	EUR 339

Mouse Thyrotropin receptor, Tshr ELISA KIT
ELI-40186m	Lifescience Market	96 Tests	EUR 865

Porcine Thyrotropin receptor, TSHR ELISA KIT
ELI-40367p	Lifescience Market	96 Tests	EUR 928

Tshr sgRNA CRISPR Lentivector set (Rat)
K6773901	ABM	3 x 1.0 ug	EUR 339

TSHR sgRNA CRISPR Lentivector set (Human)
K2539601	ABM	3 x 1.0 ug	EUR 339

Recombinant Thyroid Stimulating Hormone Receptor (TSHR)
4-RPC825Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 48.3kDa Isoelectric Point: 5.4
Description: Recombinant Human Thyroid Stimulating Hormone Receptor expressed in: E.coli

Recombinant Thyroid Stimulating Hormone Receptor (TSHR)
4-RPC825Ra01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P21463 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.1KDa Isoelectric Point: Inquire
Description: Recombinant Rat Thyroid Stimulating Hormone Receptor expressed in: E.coli

human thyroid-stimulating hormone receptor antibody,TSHR ELISA Kit
CN-04162H1	ChemNorm	96T	EUR 464

human thyroid-stimulating hormone receptor antibody,TSHR ELISA Kit
CN-04162H2	ChemNorm	48T	EUR 313

Human Thyroid-Stimulating Hormone Receptor (TSHR) Protein
20-abx060230	Abbexa	EUR 495.00 EUR 1803.00	100 ug 1 mg
Shipped within 5-10 working days.

Human Thyroid-Stimulating Hormone Receptor (TSHR) Protein
20-abx060264	Abbexa	EUR 523.00 EUR 2110.00	100 ug 1 mg
Shipped within 5-10 working days.

Rat Thyroid Stimulating Hormone Receptor (TSHR) Protein
20-abx167573	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Thyroid Stimulating Hormone Receptor (TSHR) Protein
20-abx652205	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tshr sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4871002	ABM	1.0 ug DNA	EUR 154

Tshr sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4871003	ABM	1.0 ug DNA	EUR 154

Tshr sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4871004	ABM	1.0 ug DNA	EUR 154

Tshr sgRNA CRISPR Lentivector (Rat) (Target 1)
K6773902	ABM	1.0 ug DNA	EUR 154

Tshr sgRNA CRISPR Lentivector (Rat) (Target 2)
K6773903	ABM	1.0 ug DNA	EUR 154

Tshr sgRNA CRISPR Lentivector (Rat) (Target 3)
K6773904	ABM	1.0 ug DNA	EUR 154

TSHR sgRNA CRISPR Lentivector (Human) (Target 1)
K2539602	ABM	1.0 ug DNA	EUR 154

TSHR sgRNA CRISPR Lentivector (Human) (Target 2)
K2539603	ABM	1.0 ug DNA	EUR 154

TSHR sgRNA CRISPR Lentivector (Human) (Target 3)
K2539604	ABM	1.0 ug DNA	EUR 154

TSHR Protein Vector (Rat) (pPB-C-His)
PV313298	ABM	500 ng	EUR 1191

TSHR Protein Vector (Rat) (pPB-N-His)
PV313299	ABM	500 ng	EUR 1191

TSHR Protein Vector (Rat) (pPM-C-HA)
PV313300	ABM	500 ng	EUR 1191

TSHR Protein Vector (Rat) (pPM-C-His)
PV313301	ABM	500 ng	EUR 1191

TSHR Protein Vector (Mouse) (pPB-C-His)
PV242286	ABM	500 ng	EUR 1065

TSHR Protein Vector (Mouse) (pPB-N-His)
PV242287	ABM	500 ng	EUR 1065

TSHR Protein Vector (Mouse) (pPM-C-HA)
PV242288	ABM	500 ng	EUR 1065

TSHR Protein Vector (Mouse) (pPM-C-His)
PV242289	ABM	500 ng	EUR 1065

TSHR Protein Vector (Mouse) (pPB-C-His)
PV242290	ABM	500 ng	EUR 603

TSHR Protein Vector (Mouse) (pPB-N-His)
PV242291	ABM	500 ng	EUR 603

TSHR Protein Vector (Mouse) (pPM-C-HA)
PV242292	ABM	500 ng	EUR 603

TSHR Protein Vector (Mouse) (pPM-C-His)
PV242293	ABM	500 ng	EUR 603

TSHR Protein Vector (Human) (pPB-C-His)
PV044189	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPB-N-His)
PV044190	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPM-C-HA)
PV044191	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPM-C-His)
PV044192	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPB-C-His)
PV044193	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPB-N-His)
PV044194	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPM-C-HA)
PV044195	ABM	500 ng	EUR 329

TSHR Protein Vector (Human) (pPM-C-His)
PV044196	ABM	500 ng	EUR 329

Tshr 3'UTR Luciferase Stable Cell Line
TU121226	ABM	1.0 ml	Ask for price

TSHR 3'UTR GFP Stable Cell Line
TU077295	ABM	1.0 ml	EUR 1521

Tshr 3'UTR GFP Stable Cell Line
TU171226	ABM	1.0 ml	Ask for price

Tshr 3'UTR Luciferase Stable Cell Line
TU222543	ABM	1.0 ml	Ask for price

TSHR 3'UTR Luciferase Stable Cell Line
TU027295	ABM	1.0 ml	EUR 1521

Tshr 3'UTR GFP Stable Cell Line
TU272543	ABM	1.0 ml	Ask for price

TSHR ELISA Kit (Human) : 96 Wells (OKEH02022)
OKEH02022	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23 pg/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

TSHR Rabbit Polyclonal Antibody