DERL3 Rabbit Polyclonal Antibody

DERL3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DERL3 Polyclonal Antibody

ES11969-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 Polyclonal Antibody

ES11969-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL3 antibody

70R-6365 50 ug
EUR 467
Description: Rabbit polyclonal DERL3 antibody raised against the middle region of DERL3

DERL3 antibody

70R-6366 50 ug
EUR 467
Description: Rabbit polyclonal DERL3 antibody raised against the C terminal of DERL3

Anti-DERL3 antibody

STJ193127 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DERL3

DERL3 siRNA

20-abx914024
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DERL3 siRNA

20-abx914025
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal Derlin-3 / DERL3 Antibody (N-Terminus)

APR15724G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Derlin-3 / DERL3 (N-Terminus). This antibody is tested and proven to work in the following applications:

DERL3 Blocking Peptide

33R-2886 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6365

DERL3 Blocking Peptide

33R-10295 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6366

DERL3 cloning plasmid

CSB-CL836283HU-10ug 10ug
EUR 308
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcac
  • Show more
Description: A cloning plasmid for the DERL3 gene.

Mouse DERL3 shRNA Plasmid

20-abx977193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DERL3 shRNA Plasmid

20-abx964027
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DERL3 Recombinant Protein (Human)

RP009172 100 ug Ask for price

DERL3 Recombinant Protein (Rat)

RP197897 100 ug Ask for price

DERL3 Recombinant Protein (Mouse)

RP128810 100 ug Ask for price

Derl3 ORF Vector (Rat) (pORF)

ORF065967 1.0 ug DNA
EUR 506

DERL3 ORF Vector (Human) (pORF)

ORF003058 1.0 ug DNA
EUR 95

Derl3 ORF Vector (Mouse) (pORF)

ORF042938 1.0 ug DNA
EUR 506

Human Derlin- 3, DERL3 ELISA KIT

ELI-26357h 96 Tests
EUR 824

Bovine Derlin- 3, DERL3 ELISA KIT

ELI-46941b 96 Tests
EUR 928

Mouse Derlin- 3, Derl3 ELISA KIT

ELI-47008m 96 Tests
EUR 865

DERL3 sgRNA CRISPR Lentivector set (Human)

K0585401 3 x 1.0 ug
EUR 339

Derl3 sgRNA CRISPR Lentivector set (Rat)

K6111901 3 x 1.0 ug
EUR 339

Derl3 sgRNA CRISPR Lentivector set (Mouse)

K4041101 3 x 1.0 ug
EUR 339

Human Derlin 3(DERL3)ELISA Kit

QY-E04982 96T
EUR 361

DERL3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0585402 1.0 ug DNA
EUR 154

DERL3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0585403 1.0 ug DNA
EUR 154

DERL3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0585404 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6111902 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6111903 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6111904 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4041102 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4041103 1.0 ug DNA
EUR 154

Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4041104 1.0 ug DNA
EUR 154

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-48T 48T
EUR 354
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-3 (DERL3)

KTE10361-96T 96T
EUR 572
  • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-48T 48T
EUR 332
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-3 (DERL3)

KTE71307-96T 96T
EUR 539
  • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL3 Protein Vector (Mouse) (pPB-C-His)

PV171750 500 ng
EUR 603

DERL3 Protein Vector (Mouse) (pPB-N-His)

PV171751 500 ng
EUR 603

DERL3 Protein Vector (Mouse) (pPM-C-HA)

PV171752 500 ng
EUR 603

DERL3 Protein Vector (Mouse) (pPM-C-His)

PV171753 500 ng
EUR 603

DERL3 Protein Vector (Rat) (pPB-C-His)

PV263866 500 ng
EUR 603

DERL3 Protein Vector (Rat) (pPB-N-His)

PV263867 500 ng
EUR 603

DERL3 Protein Vector (Rat) (pPM-C-HA)

PV263868 500 ng
EUR 603

DERL3 Protein Vector (Rat) (pPM-C-His)

PV263869 500 ng
EUR 603

DERL3 Protein Vector (Human) (pPB-C-His)

PV012229 500 ng
EUR 329

DERL3 Protein Vector (Human) (pPB-N-His)

PV012230 500 ng
EUR 329

DERL3 Protein Vector (Human) (pPM-C-HA)

PV012231 500 ng
EUR 329

DERL3 Rabbit Polyclonal Antibody