DERL3 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
DERL3 Polyclonal Antibody |
ES11969-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DERL3 Polyclonal Antibody |
ES11969-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DERL3 antibody |
70R-6365 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DERL3 antibody raised against the middle region of DERL3 |
DERL3 antibody |
70R-6366 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DERL3 antibody raised against the C terminal of DERL3 |
Anti-DERL3 antibody |
STJ193127 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DERL3 |
DERL3 siRNA |
20-abx914024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DERL3 siRNA |
20-abx914025 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal Derlin-3 / DERL3 Antibody (N-Terminus) |
APR15724G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Derlin-3 / DERL3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
DERL3 Blocking Peptide |
33R-2886 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6365 |
DERL3 Blocking Peptide |
33R-10295 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6366 |
DERL3 cloning plasmid |
CSB-CL836283HU-10ug |
Cusabio |
10ug |
EUR 308 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 708
- Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcac
- Show more
|
Description: A cloning plasmid for the DERL3 gene. |
Mouse DERL3 shRNA Plasmid |
20-abx977193 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DERL3 shRNA Plasmid |
20-abx964027 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DERL3 Recombinant Protein (Human) |
RP009172 |
ABM |
100 ug |
Ask for price |
DERL3 Recombinant Protein (Rat) |
RP197897 |
ABM |
100 ug |
Ask for price |
DERL3 Recombinant Protein (Mouse) |
RP128810 |
ABM |
100 ug |
Ask for price |
Derl3 ORF Vector (Rat) (pORF) |
ORF065967 |
ABM |
1.0 ug DNA |
EUR 506 |
DERL3 ORF Vector (Human) (pORF) |
ORF003058 |
ABM |
1.0 ug DNA |
EUR 95 |
Derl3 ORF Vector (Mouse) (pORF) |
ORF042938 |
ABM |
1.0 ug DNA |
EUR 506 |
DERL3 sgRNA CRISPR Lentivector set (Human) |
K0585401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Derl3 sgRNA CRISPR Lentivector set (Rat) |
K6111901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Derl3 sgRNA CRISPR Lentivector set (Mouse) |
K4041101 |
ABM |
3 x 1.0 ug |
EUR 339 |
DERL3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0585402 |
ABM |
1.0 ug DNA |
EUR 154 |
DERL3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0585403 |
ABM |
1.0 ug DNA |
EUR 154 |
DERL3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0585404 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6111902 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6111903 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6111904 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4041102 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4041103 |
ABM |
1.0 ug DNA |
EUR 154 |
Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4041104 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Bovine Derlin-3 (DERL3) |
KTE10361-48T |
Abbkine |
48T |
EUR 354 |
- Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Derlin-3 (DERL3) |
KTE10361-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Derlin-3 (DERL3) |
KTE10361-96T |
Abbkine |
96T |
EUR 572 |
- Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Derlin-3 (DERL3) |
KTE71307-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Derlin-3 (DERL3) |
KTE71307-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Derlin-3 (DERL3) |
KTE71307-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DERL3 Protein Vector (Mouse) (pPB-C-His) |
PV171750 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Mouse) (pPB-N-His) |
PV171751 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Mouse) (pPM-C-HA) |
PV171752 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Mouse) (pPM-C-His) |
PV171753 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Rat) (pPB-C-His) |
PV263866 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Rat) (pPB-N-His) |
PV263867 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Rat) (pPM-C-HA) |
PV263868 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Rat) (pPM-C-His) |
PV263869 |
ABM |
500 ng |
EUR 603 |
DERL3 Protein Vector (Human) (pPB-C-His) |
PV012229 |
ABM |
500 ng |
EUR 329 |
DERL3 Protein Vector (Human) (pPB-N-His) |
PV012230 |
ABM |
500 ng |
EUR 329 |
DERL3 Protein Vector (Human) (pPM-C-HA) |
PV012231 |
ABM |
500 ng |
EUR 329 |
DERL3 Rabbit Polyclonal Antibody