HEY1 Rabbit Polyclonal Antibody

HEY1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

HEY1 Polyclonal Antibody

A69347 100 ?g
EUR 628.55
Description: kits suitable for this type of research

HEY1 Polyclonal Antibody

ABP58777-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody

ABP58777-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody

ABP58777-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein

HEY1 Polyclonal Antibody

ES11908-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

HEY1 Polyclonal Antibody

ES11908-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Rabbit Anti Human Hey1 Polyclonal Antibody

CPBT-67678RH 25 µg
EUR 559

HEY1 Rabbit pAb

A16110-100ul 100 ul
EUR 308

HEY1 Rabbit pAb

A16110-200ul 200 ul
EUR 459

HEY1 Rabbit pAb

A16110-20ul 20 ul
EUR 183

HEY1 Rabbit pAb

A16110-50ul 50 ul
EUR 223

HEY1 Polyclonal Conjugated Antibody

C29727 100ul
EUR 397

HEY1 antibody

70R-17727 50 ul
EUR 435
Description: Rabbit polyclonal HEY1 antibody

HEY1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

HEY1 Antibody

DF12076 200ul
EUR 304
Description: HEY1 antibody detects endogenous levels of HEY1.

Hey1 antibody

70R-7932 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hey1 antibody

HEY1 antibody

70R-5241 50 ug
EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the middle region of HEY1

HEY1 antibody

70R-5242 50 ug
EUR 467
Description: Rabbit polyclonal HEY1 antibody raised against the N terminal of HEY1

HEY1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal HEY1 antibody - middle region

APR00803G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - middle region. This antibody is tested and proven to work in the following applications:

HEY1 Polyclonal Antibody, HRP Conjugated

A69348 100 ?g
EUR 628.55
Description: fast delivery possible

HEY1 Polyclonal Antibody, FITC Conjugated

A69349 100 ?g
EUR 628.55
Description: reagents widely cited

HEY1 Polyclonal Antibody, Biotin Conjugated

A69350 100 ?g
EUR 628.55
Description: Ask the seller for details

Polyclonal HEY1 Antibody - C-terminal region

APR00612G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal HEY1 antibody - N-terminal region

APR00802G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal HEY1 Antibody - C-terminal region

APR01885G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications:

anti- HEY1 antibody

FNab03849 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: hairy/enhancer-of-split related with YRPW motif 1
  • Uniprot ID: Q9Y5J3
  • Gene ID: 23462
  • Research Area: Cardiovascular, Metabolism, Developmental biology
Description: Antibody raised against HEY1

Anti-HEY1 antibody

PAab03849 100 ug
EUR 355

Anti-HEY1 antibody

STJ118563 100 µl
EUR 277

Anti-HEY1 antibody

STJ193066 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HEY1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17696 2 ug
EUR 231


YF-PA17897 50 ul
EUR 363
Description: Mouse polyclonal to HEY1

HEY1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HEY1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HEY1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HEY1 Blocking Peptide

33R-3822 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEY1 antibody, catalog no. 70R-5241

HEY1 Blocking Peptide

33R-1335 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHST13 antibody, catalog no. 70R-7171

Hey1 Blocking Peptide

33R-9951 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hey1 antibody, catalog no. 70R-7932

HEY1 cloning plasmid

CSB-CL896909HU-10ug 10ug
EUR 366
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 915
  • Sequence: atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaa
  • Show more
Description: A cloning plasmid for the HEY1 gene.

HEY1 Blocking Peptide

DF12076-BP 1mg
EUR 195

Anti-HEY1 (3B3)

YF-MA11407 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (2F10)

YF-MA17895 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1B9)

YF-MA17896 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3B2)

YF-MA17897 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1E10)

YF-MA17898 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1C9)

YF-MA17899 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (4B3)

YF-MA17900 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3G10)

YF-MA17901 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (1F11)

YF-MA17902 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3D1)

YF-MA17903 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3E5)

YF-MA17904 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (4A3)

YF-MA17905 100 ug
EUR 363
Description: Mouse monoclonal to HEY1

Anti-HEY1 (3B4)

YF-MA17906 100 ug
EUR 363
Description: Mouse monoclonal to HEY1


ELI-13056b 96 Tests
EUR 928


ELI-20889h 96 Tests
EUR 824

Mouse Hey1 ELISA KIT

ELI-08572m 96 Tests
EUR 865


EF010111 96 Tests
EUR 689

Human HEY1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48591d 96 Tests
EUR 928

HEY1 Recombinant Protein (Human)

RP014608 100 ug Ask for price

HEY1 Recombinant Protein (Rat)

RP204491 100 ug Ask for price

HEY1 Recombinant Protein (Mouse)

RP141374 100 ug Ask for price

Monoclonal HEY1 Antibody (monoclonal) (M07), Clone: 4B3

AMM03619G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in E

Monoclonal HEY1 Antibody (monoclonal) (M09), Clone: 1F11

AMM03620G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1F11. This antibody is applicable in WB and IF, E

Hey1 ORF Vector (Rat) (pORF)

ORF068165 1.0 ug DNA
EUR 506

HEY1 ORF Vector (Human) (pORF)

ORF004870 1.0 ug DNA
EUR 95

Hey1 ORF Vector (Mouse) (pORF)

ORF047126 1.0 ug DNA
EUR 506

pGEX-4T-1-HEY1 Plasmid

PVTB00542-1a 2 ug
EUR 356

Hey1 sgRNA CRISPR Lentivector set (Rat)

K7084601 3 x 1.0 ug
EUR 339

Hey1 sgRNA CRISPR Lentivector set (Mouse)

K4335501 3 x 1.0 ug
EUR 339

HEY1 sgRNA CRISPR Lentivector set (Human)

K0948201 3 x 1.0 ug
EUR 339

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7084602 1.0 ug DNA
EUR 154

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7084603 1.0 ug DNA
EUR 154

Hey1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7084604 1.0 ug DNA
EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4335502 1.0 ug DNA
EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4335503 1.0 ug DNA
EUR 154

Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4335504 1.0 ug DNA
EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0948202 1.0 ug DNA
EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0948203 1.0 ug DNA
EUR 154

HEY1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0948204 1.0 ug DNA
EUR 154

HEY1 Protein Vector (Rat) (pPB-C-His)

PV272658 500 ng
EUR 603

HEY1 Protein Vector (Rat) (pPB-N-His)

PV272659 500 ng
EUR 603

HEY1 Protein Vector (Rat) (pPM-C-HA)

PV272660 500 ng
EUR 603

HEY1 Protein Vector (Rat) (pPM-C-His)

PV272661 500 ng
EUR 603

HEY1 Protein Vector (Mouse) (pPB-C-His)

PV188502 500 ng
EUR 603

HEY1 Protein Vector (Mouse) (pPB-N-His)

PV188503 500 ng
EUR 603

HEY1 Protein Vector (Mouse) (pPM-C-HA)

PV188504 500 ng
EUR 603

HEY1 Protein Vector (Mouse) (pPM-C-His)

PV188505 500 ng
EUR 603

HEY1 Protein Vector (Human) (pPB-C-His)

PV019477 500 ng
EUR 329

HEY1 Protein Vector (Human) (pPB-N-His)

PV019478 500 ng
EUR 329

HEY1 Protein Vector (Human) (pPM-C-HA)

PV019479 500 ng
EUR 329

HEY1 Protein Vector (Human) (pPM-C-His)

PV019480 500 ng
EUR 329

Hey1 3'UTR Luciferase Stable Cell Line

TU109476 1.0 ml Ask for price

Hey1 3'UTR Luciferase Stable Cell Line

TU205746 1.0 ml Ask for price

Hey1 3'UTR GFP Stable Cell Line

TU159476 1.0 ml Ask for price

Hey1 3'UTR GFP Stable Cell Line

TU255746 1.0 ml Ask for price

HEY1 3'UTR GFP Stable Cell Line

TU059745 1.0 ml
EUR 1394

HEY1 Rabbit Polyclonal Antibody