HEY1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 HEY1 Polyclonal Antibody |
|
A69347 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: kits suitable for this type of research |
HEY1 Polyclonal Antibody |
|
ABP58777-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein |
HEY1 Polyclonal Antibody |
|
ABP58777-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein |
HEY1 Polyclonal Antibody |
|
ABP58777-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HEY1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HEY1 from Human, Mouse. This HEY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HEY1 protein |
HEY1 Polyclonal Antibody |
|
ES11908-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HEY1 Polyclonal Antibody |
|
ES11908-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HEY1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 HEY1 Rabbit pAb |
|
A16110-100ul |
Abclonal |
100 ul |
EUR 308 |
HEY1 Rabbit pAb |
|
A16110-200ul |
Abclonal |
200 ul |
EUR 459 |
HEY1 Rabbit pAb |
|
A16110-20ul |
Abclonal |
20 ul |
EUR 183 |
HEY1 Rabbit pAb |
|
A16110-50ul |
Abclonal |
50 ul |
EUR 223 |
 HEY1 Polyclonal Conjugated Antibody |
|
C29727 |
SAB |
100ul |
EUR 397 |
 HEY1 antibody |
|
70R-17727 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal HEY1 antibody |
 HEY1 Antibody |
|
1-CSB-PA896909LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
HEY1 Antibody |
|
DF12076 |
Affbiotech |
200ul |
EUR 304 |
|
Description: HEY1 antibody detects endogenous levels of HEY1. |
 Hey1 antibody |
|
70R-7932 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal Hey1 antibody |
HEY1 antibody |
|
70R-5241 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal HEY1 antibody raised against the middle region of HEY1 |
HEY1 antibody |
|
70R-5242 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal HEY1 antibody raised against the N terminal of HEY1 |
HEY1 Antibody |
|
1-CSB-PA010320GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 Polyclonal HEY1 antibody - middle region |
|
APR00803G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - middle region. This antibody is tested and proven to work in the following applications: |
 HEY1 Polyclonal Antibody, HRP Conjugated |
|
A69348 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
 HEY1 Polyclonal Antibody, FITC Conjugated |
|
A69349 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
 HEY1 Polyclonal Antibody, Biotin Conjugated |
|
A69350 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: Ask the seller for details |
 Polyclonal HEY1 Antibody - C-terminal region |
|
APR00612G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 Polyclonal HEY1 antibody - N-terminal region |
|
APR00802G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal HEY1 Antibody - C-terminal region |
|
APR01885G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEY1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 anti- HEY1 antibody |
|
FNab03849 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: hairy/enhancer-of-split related with YRPW motif 1
- Uniprot ID: Q9Y5J3
- Gene ID: 23462
- Research Area: Cardiovascular, Metabolism, Developmental biology
|
|
Description: Antibody raised against HEY1 |
 Anti-HEY1 antibody |
|
STJ193066 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to HEY1 |
 HEY1 siRNA |
|
20-abx919305 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-HEY1 |
|
YF-PA17897 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to HEY1 |
 HEY1 Antibody, HRP conjugated |
|
1-CSB-PA896909LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 HEY1 Antibody, FITC conjugated |
|
1-CSB-PA896909LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 HEY1 Antibody, Biotin conjugated |
|
1-CSB-PA896909LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against HEY1. Recognizes HEY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 HEY1 Blocking Peptide |
|
33R-3822 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HEY1 antibody, catalog no. 70R-5241 |
HEY1 Blocking Peptide |
|
33R-1335 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHST13 antibody, catalog no. 70R-7171 |
 Hey1 Blocking Peptide |
|
33R-9951 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hey1 antibody, catalog no. 70R-7932 |
 HEY1 cloning plasmid |
|
CSB-CL896909HU-10ug |
Cusabio |
10ug |
EUR 366 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 915
- Sequence: atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaa
- Show more
|
|
Description: A cloning plasmid for the HEY1 gene. |
HEY1 Blocking Peptide |
|
DF12076-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-HEY1 (3B3) |
|
YF-MA11407 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (2F10) |
|
YF-MA17895 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (1B9) |
|
YF-MA17896 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (3B2) |
|
YF-MA17897 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (1E10) |
|
YF-MA17898 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (1C9) |
|
YF-MA17899 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (4B3) |
|
YF-MA17900 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (3G10) |
|
YF-MA17901 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (1F11) |
|
YF-MA17902 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (3D1) |
|
YF-MA17903 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (3E5) |
|
YF-MA17904 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (4A3) |
|
YF-MA17905 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
) Anti-HEY1 (3B4) |
|
YF-MA17906 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to HEY1 |
 Human HEY1 shRNA Plasmid |
|
20-abx958284 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) HEY1 Recombinant Protein (Human) |
|
RP014608 |
ABM |
100 ug |
Ask for price |
) HEY1 Recombinant Protein (Rat) |
|
RP204491 |
ABM |
100 ug |
Ask for price |
) HEY1 Recombinant Protein (Mouse) |
|
RP141374 |
ABM |
100 ug |
Ask for price |
 (M07), Clone: 4B3) Monoclonal HEY1 Antibody (monoclonal) (M07), Clone: 4B3 |
|
AMM03619G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in E |
 (M09), Clone: 1F11) Monoclonal HEY1 Antibody (monoclonal) (M09), Clone: 1F11 |
|
AMM03620G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human HEY1 (monoclonal) (M09). The antibodies are raised in mouse and are from clone 1F11. This antibody is applicable in WB and IF, E |
 (pORF)) Hey1 ORF Vector (Rat) (pORF) |
|
ORF068165 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) HEY1 ORF Vector (Human) (pORF) |
|
ORF004870 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Hey1 ORF Vector (Mouse) (pORF) |
|
ORF047126 |
ABM |
1.0 ug DNA |
EUR 506 |
) Hey1 sgRNA CRISPR Lentivector set (Rat) |
|
K7084601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Hey1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4335501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) HEY1 sgRNA CRISPR Lentivector set (Human) |
|
K0948201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Hey1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7084602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Hey1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7084603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Hey1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7084604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4335502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4335503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Hey1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4335504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) HEY1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0948202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) HEY1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0948203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) HEY1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0948204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) HEY1 Protein Vector (Rat) (pPB-C-His) |
|
PV272658 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) HEY1 Protein Vector (Rat) (pPB-N-His) |
|
PV272659 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) HEY1 Protein Vector (Rat) (pPM-C-HA) |
|
PV272660 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) HEY1 Protein Vector (Rat) (pPM-C-His) |
|
PV272661 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) HEY1 Protein Vector (Mouse) (pPB-C-His) |
|
PV188502 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) HEY1 Protein Vector (Mouse) (pPB-N-His) |
|
PV188503 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) HEY1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV188504 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) HEY1 Protein Vector (Mouse) (pPM-C-His) |
|
PV188505 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) HEY1 Protein Vector (Human) (pPB-C-His) |
|
PV019477 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) HEY1 Protein Vector (Human) (pPB-N-His) |
|
PV019478 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) HEY1 Protein Vector (Human) (pPM-C-HA) |
|
PV019479 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) HEY1 Protein Vector (Human) (pPM-C-His) |
|
PV019480 |
ABM |
500 ng |
EUR 329 |
 Hey1 3'UTR Luciferase Stable Cell Line |
|
TU109476 |
ABM |
1.0 ml |
Ask for price |
Hey1 3'UTR Luciferase Stable Cell Line |
|
TU205746 |
ABM |
1.0 ml |
Ask for price |
 Hey1 3'UTR GFP Stable Cell Line |
|
TU159476 |
ABM |
1.0 ml |
Ask for price |
Hey1 3'UTR GFP Stable Cell Line |
|
TU255746 |
ABM |
1.0 ml |
Ask for price |
 HEY1 3'UTR GFP Stable Cell Line |
|
TU059745 |
ABM |
1.0 ml |
EUR 1394 |
HEY1 Rabbit Polyclonal Antibody
