GPR78 Rabbit Polyclonal Antibody

GPR78 Rabbit Polyclonal Antibody

To Order Now:

GPR78 Polyclonal Antibody

ABP58697-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

GPR78 Polyclonal Antibody

ABP58697-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370

GPR78 Rabbit pAb

A12364-100ul 100 ul
EUR 308

GPR78 Rabbit pAb

A12364-200ul 200 ul
EUR 459

GPR78 Rabbit pAb

A12364-20ul 20 ul
EUR 183

GPR78 Rabbit pAb

A12364-50ul 50 ul
EUR 223

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

DLR-GPR78-Hu-48T 48T
EUR 517
  • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

DLR-GPR78-Hu-96T 96T
EUR 673
  • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

RD-GPR78-Hu-48Tests 48 Tests
EUR 521

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

RD-GPR78-Hu-96Tests 96 Tests
EUR 723

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

RDR-GPR78-Hu-48Tests 48 Tests
EUR 544

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit

RDR-GPR78-Hu-96Tests 96 Tests
EUR 756

GPR78 Antibody

ABD2763 100 ug
EUR 438

GPR78 Antibody

37609-100ul 100ul
EUR 252

GPR78 Antibody

DF2763 200ul
EUR 304
Description: GPR78 antibody detects endogenous levels of total GPR78.

GPR78 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Polyclonal GPR78 Antibody (C-Terminus)

APR16605G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR78 Antibody (Cytoplasmic Domain)

APR16606G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

GPR78 Conjugated Antibody

C37609 100ul
EUR 397

Anti-GPR78 antibody

STJ114242 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.

Anti-GPR78 antibody

STJ192638 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR78

Polyclonal GPR78 Antibody - C-terminal region

APR16607G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications:


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR78 Blocking Peptide

DF2763-BP 1mg
EUR 195

GPR78 cloning plasmid

CSB-CL850406HU-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg
  • Show more
Description: A cloning plasmid for the GPR78 gene.

Human GPR78 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR78 Recombinant Protein (Human)

RP013894 100 ug Ask for price

G Protein Coupled Receptor 78 (GPR78) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody

abx029634-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody

abx029634-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

G Protein Coupled Receptor 78 (GPR78) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

GPR78 Rabbit Polyclonal Antibody