GPR78 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 GPR78 Polyclonal Antibody |
|
ES11480-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GPR78 Polyclonal Antibody |
|
ES11480-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 GPR78 Rabbit pAb |
|
A12364-100ul |
Abclonal |
100 ul |
EUR 308 |
GPR78 Rabbit pAb |
|
A12364-200ul |
Abclonal |
200 ul |
EUR 459 |
GPR78 Rabbit pAb |
|
A12364-20ul |
Abclonal |
20 ul |
EUR 183 |
GPR78 Rabbit pAb |
|
A12364-50ul |
Abclonal |
50 ul |
EUR 223 |
 ELISA Kit) Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
DLR-GPR78-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids. |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
DLR-GPR78-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids. |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
RDR-GPR78-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
RDR-GPR78-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
RD-GPR78-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
|
RD-GPR78-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 GPR78 Antibody |
|
37609-100ul |
SAB |
100ul |
EUR 252 |
GPR78 Antibody |
|
DF2763 |
Affbiotech |
200ul |
EUR 304 |
|
Description: GPR78 antibody detects endogenous levels of total GPR78. |
GPR78 Antibody |
|
1-CSB-PA419324 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
) Polyclonal GPR78 Antibody (C-Terminus) |
|
APR16605G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal GPR78 Antibody (Cytoplasmic Domain) |
|
APR16606G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
 GPR78 Conjugated Antibody |
|
C37609 |
SAB |
100ul |
EUR 397 |
 Anti-GPR78 antibody |
|
STJ114242 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene. |
Anti-GPR78 antibody |
|
STJ192638 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to GPR78 |
 Polyclonal GPR78 Antibody - C-terminal region |
|
APR16607G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 GPR78 siRNA |
|
20-abx918555 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 GPR78 Blocking Peptide |
|
DF2763-BP |
Affbiotech |
1mg |
EUR 195 |
 GPR78 cloning plasmid |
|
CSB-CL850406HU-10ug |
Cusabio |
10ug |
EUR 415 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1092
- Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg
- Show more
|
|
Description: A cloning plasmid for the GPR78 gene. |
 Human GPR78 shRNA Plasmid |
|
20-abx959021 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GPR78 Recombinant Protein (Human) |
|
RP013894 |
ABM |
100 ug |
Ask for price |
 (pORF)) GPR78 ORF Vector (Human) (pORF) |
|
ORF004632 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKCD08975)) GPR78 ELISA Kit (Human) (OKCD08975) |
|
OKCD08975 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL |
 (OKDD00294)) GPR78 ELISA Kit (Human) (OKDD00294) |
|
OKDD00294 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL |
 Antibody) G Protein Coupled Receptor 78 (GPR78) Antibody |
|
20-abx176531 |
Abbexa |
|
|
|
|
GPR78 Rabbit Polyclonal Antibody
