GPR78 Rabbit Polyclonal Antibody

GPR78 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GPR78 Polyclonal Antibody
ES11480-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR78 Polyclonal Antibody
ES11480-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR78 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR78 Rabbit pAb
A12364-100ul 100 ul
EUR 308

GPR78 Rabbit pAb
A12364-200ul 200 ul
EUR 459

GPR78 Rabbit pAb
A12364-20ul 20 ul
EUR 183

GPR78 Rabbit pAb
A12364-50ul 50 ul
EUR 223

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
DLR-GPR78-Hu-48T 48T
EUR 517
  • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
DLR-GPR78-Hu-96T 96T
EUR 673
  • Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids.

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RDR-GPR78-Hu-48Tests 48 Tests
EUR 544

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RDR-GPR78-Hu-96Tests 96 Tests
EUR 756

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RD-GPR78-Hu-48Tests 48 Tests
EUR 521

Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit
RD-GPR78-Hu-96Tests 96 Tests
EUR 723

GPR78 Antibody
37609-100ul 100ul
EUR 252

GPR78 Antibody
DF2763 200ul
EUR 304
Description: GPR78 antibody detects endogenous levels of total GPR78.

GPR78 Antibody
1-CSB-PA419324
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

GPR78 Antibody
ABD2763 100 ug
EUR 438

Polyclonal GPR78 Antibody (C-Terminus)
APR16605G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR78 Antibody (Cytoplasmic Domain)
APR16606G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

GPR78 Conjugated Antibody
C37609 100ul
EUR 397

Anti-GPR78 antibody
STJ114242 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.

Anti-GPR78 antibody
STJ192638 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR78

Polyclonal GPR78 Antibody - C-terminal region
APR16607G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications:

GPR78 siRNA
20-abx918555
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR78 Blocking Peptide
DF2763-BP 1mg
EUR 195

GPR78 cloning plasmid
CSB-CL850406HU-10ug 10ug
EUR 415
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg
  • Show more
Description: A cloning plasmid for the GPR78 gene.

Human GPR78 shRNA Plasmid
20-abx959021
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR78 Recombinant Protein (Human)
RP013894 100 ug Ask for price

GPR78 ORF Vector (Human) (pORF)
ORF004632 1.0 ug DNA
EUR 95

GPR78 ELISA Kit (Human) (OKCD08975)
OKCD08975 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

GPR78 ELISA Kit (Human) (OKDD00294)
OKDD00294 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

G Protein Coupled Receptor 78 (GPR78) Antibody
20-abx176531
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

GPR78 Rabbit Polyclonal Antibody