GPR78 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
GPR78 Polyclonal Antibody |
ABP58697-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370 |
GPR78 Polyclonal Antibody |
ABP58697-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of GPR78 from Human. This GPR78 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR78 protein at amino acid sequence of 290-370 |
GPR78 Rabbit pAb |
A12364-100ul |
Abclonal |
100 ul |
EUR 308 |
GPR78 Rabbit pAb |
A12364-200ul |
Abclonal |
200 ul |
EUR 459 |
GPR78 Rabbit pAb |
A12364-20ul |
Abclonal |
20 ul |
EUR 183 |
GPR78 Rabbit pAb |
A12364-50ul |
Abclonal |
50 ul |
EUR 223 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
DLR-GPR78-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids. |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
DLR-GPR78-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Receptor 78 (GPR78) in samples from tissue homogenates or other biological fluids. |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
RD-GPR78-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
RD-GPR78-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
RDR-GPR78-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human G Protein Coupled Receptor 78 (GPR78) ELISA Kit |
RDR-GPR78-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
GPR78 Antibody |
37609-100ul |
SAB |
100ul |
EUR 252 |
GPR78 Antibody |
DF2763 |
Affbiotech |
200ul |
EUR 304 |
Description: GPR78 antibody detects endogenous levels of total GPR78. |
GPR78 Antibody |
1-CSB-PA419324 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GPR78. Recognizes GPR78 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
Polyclonal GPR78 Antibody (C-Terminus) |
APR16605G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal GPR78 Antibody (Cytoplasmic Domain) |
APR16606G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
GPR78 Conjugated Antibody |
C37609 |
SAB |
100ul |
EUR 397 |
Anti-GPR78 antibody |
STJ114242 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene. |
Anti-GPR78 antibody |
STJ192638 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GPR78 |
Polyclonal GPR78 Antibody - C-terminal region |
APR16607G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR78 - C-terminal region. This antibody is tested and proven to work in the following applications: |
GPR78 siRNA |
20-abx918555 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPR78 Blocking Peptide |
DF2763-BP |
Affbiotech |
1mg |
EUR 195 |
GPR78 cloning plasmid |
CSB-CL850406HU-10ug |
Cusabio |
10ug |
EUR 415 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1092
- Sequence: atgggccccggcgaggcgctgctggcgggtctcctggtgatggtactggccgtggcgctgctatccaacgcactggtgctgctttgttgcgcctacagcgctgagctccgcactcgagcctcaggcgtcctcctggtgaatctgtctctgggccacctgctgctggcggcgctgg
- Show more
|
Description: A cloning plasmid for the GPR78 gene. |
Human GPR78 shRNA Plasmid |
20-abx959021 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GPR78 Recombinant Protein (Human) |
RP013894 |
ABM |
100 ug |
Ask for price |
G Protein Coupled Receptor 78 (GPR78) Antibody |
20-abx125903 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
G Protein Coupled Receptor 78 (GPR78) Antibody |
abx029634-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
G Protein Coupled Receptor 78 (GPR78) Antibody |
abx029634-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
G Protein Coupled Receptor 78 (GPR78) Antibody |
20-abx172496 |
Abbexa |
|
|
|
GPR78 Rabbit Polyclonal Antibody