RBP1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
RBP1 Polyclonal Antibody |
ABP60118-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein |
RBP1 Polyclonal Antibody |
ABP60118-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein |
RBP1 Polyclonal Antibody |
ABP60118-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein |
RBP1 Polyclonal Antibody |
27262-100ul |
SAB |
100ul |
EUR 252 |
RBP1 Polyclonal Antibody |
27262-50ul |
SAB |
50ul |
EUR 187 |
RBP1 Rabbit pAb |
A10029-100ul |
Abclonal |
100 ul |
EUR 308 |
RBP1 Rabbit pAb |
A10029-200ul |
Abclonal |
200 ul |
EUR 459 |
RBP1 Rabbit pAb |
A10029-20ul |
Abclonal |
20 ul |
EUR 183 |
RBP1 Rabbit pAb |
A10029-50ul |
Abclonal |
50 ul |
EUR 223 |
RBP1 Polyclonal Conjugated Antibody |
C27262 |
SAB |
100ul |
EUR 397 |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
DLR-RBP1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
DLR-RBP1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
RD-RBP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
RD-RBP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
RDR-RBP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit |
RDR-RBP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Polyclonal Goat Anti-RBP1 Antibody |
APG00276G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications: |
RBP1 antibody |
10R-5603 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal RBP1 antibody |
RBP1 antibody |
10R-5604 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal RBP1 antibody |
RBP1 antibody |
70R-12616 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RBP1 antibody |
RBP1 antibody |
70R-12617 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RBP1 antibody |
RBP1 antibody |
70R-1274 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1 |
RBP1 Antibody |
1-CSB-PA019480GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
|
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RBP1 Antibody |
1-CSB-PA019480YA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal RBP1 / CRBP Antibody (C-Terminus) |
APG01059G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications: |
anti- RBP1 antibody |
FNab07188 |
FN Test |
100µg |
EUR 585 |
- Immunogen: retinol binding protein 1, cellular
- Uniprot ID: P09455
- Gene ID: 5947
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against RBP1 |
Anti-RBP1 antibody |
STJ112069 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-RBP1 antibody |
STJ193046 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RBP1 |
RBP1 siRNA |
20-abx904510 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RBP1 siRNA |
20-abx931119 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RBP1 siRNA |
20-abx931120 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RBP1 Antibody, HRP conjugated |
1-CSB-PA019480YB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RBP1 Antibody, FITC conjugated |
1-CSB-PA019480YC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RBP1 Antibody, Biotin conjugated |
1-CSB-PA019480YD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RBP1 cloning plasmid |
CSB-CL019480HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 408
- Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG
- Show more
|
Description: A cloning plasmid for the RBP1 gene. |
RBP1 Blocking Peptide |
33R-4007 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274 |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine) |
4-PAA400Bo01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1) |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse) |
4-PAA400Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1) |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig) |
4-PAA400Po01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1) |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat) |
4-PAA400Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1) |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC |
4-PAA400Bo01-APC |
Cloud-Clone |
-
EUR 363.00
-
EUR 3527.00
-
EUR 975.00
-
EUR 465.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated |
4-PAA400Bo01-Biotin |
Cloud-Clone |
-
EUR 324.00
-
EUR 2644.00
-
EUR 773.00
-
EUR 399.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3 |
4-PAA400Bo01-Cy3 |
Cloud-Clone |
-
EUR 443.00
-
EUR 4661.00
-
EUR 1259.00
-
EUR 578.00
-
EUR 260.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC |
4-PAA400Bo01-FITC |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP |
4-PAA400Bo01-HRP |
Cloud-Clone |
-
EUR 331.00
-
EUR 3073.00
-
EUR 862.00
-
EUR 419.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE |
4-PAA400Bo01-PE |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC |
4-PAA400Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA400Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3 |
4-PAA400Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC |
4-PAA400Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP |
4-PAA400Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE |
4-PAA400Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC |
4-PAA400Po01-APC |
Cloud-Clone |
-
EUR 363.00
-
EUR 3527.00
-
EUR 975.00
-
EUR 465.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated |
4-PAA400Po01-Biotin |
Cloud-Clone |
-
EUR 324.00
-
EUR 2644.00
-
EUR 773.00
-
EUR 399.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3 |
4-PAA400Po01-Cy3 |
Cloud-Clone |
-
EUR 443.00
-
EUR 4661.00
-
EUR 1259.00
-
EUR 578.00
-
EUR 260.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC |
4-PAA400Po01-FITC |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP |
4-PAA400Po01-HRP |
Cloud-Clone |
-
EUR 331.00
-
EUR 3073.00
-
EUR 862.00
-
EUR 419.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE |
4-PAA400Po01-PE |
Cloud-Clone |
-
EUR 310.00
-
EUR 2841.00
-
EUR 800.00
-
EUR 392.00
-
EUR 201.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC |
4-PAA400Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated |
4-PAA400Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3 |
4-PAA400Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC |
4-PAA400Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP |
4-PAA400Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE |
4-PAA400Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE. |
Retinol-Binding Protein 1 (Rbp1) Antibody |
20-abx116773 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Retinol-Binding Protein 1 (RBP1) Antibody |
20-abx135947 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Retinol-Binding Protein 1 (RBP1) Antibody |
abx433219-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Retinol-Binding Protein 1 (RBP1) Antibody |
abx237188-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Rat RBP1 shRNA Plasmid |
20-abx984766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RBP1 shRNA Plasmid |
20-abx954026 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RBP1 protein (His tag) |
80R-2045 |
Fitzgerald |
50 ug |
EUR 322 |
Description: Recombinant human RBP1 protein (His tag) |
Mouse RBP1 shRNA Plasmid |
20-abx972405 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RBP1 Recombinant Protein (Human) |
RP042796 |
ABM |
100 ug |
Ask for price |
RBP1 Recombinant Protein (Rat) |
RP223892 |
ABM |
100 ug |
Ask for price |
RBP1 Recombinant Protein (Mouse) |
RP167303 |
ABM |
100 ug |
Ask for price |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC-Cy7 |
4-PAA400Bo01-APC-Cy7 |
Cloud-Clone |
-
EUR 607.00
-
EUR 6934.00
-
EUR 1831.00
-
EUR 810.00
-
EUR 333.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Met1~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig) |
4-PAA400Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1) |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA400Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC-Cy7 |
4-PAA400Po01-APC-Cy7 |
Cloud-Clone |
-
EUR 607.00
-
EUR 6934.00
-
EUR 1831.00
-
EUR 810.00
-
EUR 333.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Asn135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA400Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~His135)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7. |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC610872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC610872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC400872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC400872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC430872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC430872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC470872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC470872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC550872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC550872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC040872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC040872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC050872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC050872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNUB0872-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNUB0872-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNUM0872-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), 1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC680872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC680872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC700872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC700872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC940872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC940872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCH0872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCH0872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC800872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC800872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCP0872-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), PerCP conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCR0872-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), RPE conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCA0872-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), APC conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCAP0872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCAP0872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCB0872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNCB0872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC880872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC880872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC810872-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein-1(RBP1/872) Antibody |
BNC810872-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL |
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx128517 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx129519 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx130157 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx103757 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx103758 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Retinol Binding Protein 1, Cellular (RBP1) Antibody |
20-abx174395 |
Abbexa |
|
|
|
Anti-p40 Antibody Clone, Unconjugated-100ug |
8626-RBP1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Anti-beta-Catenin Antibody Clone, Unconjugated-100ug |
1499-RBP1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Anti-TIMP-3 Antibody Clone, Unconjugated-100ug |
7078-RBP1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Anti-Helicobacter Pylori Antibody Clone, Unconjugated-100ug |
RBP1-374-P1 |
EnQuireBio |
100ug |
EUR 377 |
Rbp1 ORF Vector (Rat) (pORF) |
ORF074632 |
ABM |
1.0 ug DNA |
EUR 506 |
RBP1 ORF Vector (Human) (pORF) |
ORF014266 |
ABM |
1.0 ug DNA |
EUR 354 |
Rbp1 ORF Vector (Mouse) (pORF) |
ORF055769 |
ABM |
1.0 ug DNA |
EUR 506 |
RBP1 ELISA Kit (Human) (OKAN05290) |
OKAN05290 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
RBP1 ELISA Kit (Human) (OKCD06311) |
OKCD06311 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision.RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. The gene harbors four exons encoding 24, 59, 33, and 16 amino acid residues respectively. The second intervening sequence alone occupies 19 kb of the 21 kb of the gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
RBP1 ELISA Kit (Human) (OKEH00871) |
OKEH00871 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.53 ng/mL |
RBP1 ELISA Kit (Rat) (OKEH00872) |
OKEH00872 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: binds and transports retinol; plays a role in vitamin A metabolism [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.406 ng/mL |
Rbp1 ELISA Kit (Mouse) (OKEH04661) |
OKEH04661 |
Aviva Systems Biology |
96 Wells |
EUR 1014 |
Description: Description of target: Intracellular transport of retinol.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.785 ng/mL |
RBP1 ELISA Kit (Bovine) (OKEH07808) |
OKEH07808 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32ng/mL |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC |
4-PAA400Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Biotinylated |
4-PAA400Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Cy3 |
4-PAA400Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), FITC |
4-PAA400Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), HRP |
4-PAA400Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), PE |
4-PAA400Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE. |
Monoclonal RBP1 / CRBP Antibody (clone 2E1), Clone: 2E1 |
AMM02236G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human RBP1 / CRBP (clone 2E1). The antibodies are raised in Mouse and are from clone 2E1. This antibody is applicable in WB and IHC-P, IF, Flo |
Retinol Binding Protein 1, Cellular (RBP1) Antibody (Biotin) |
20-abx273472 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Anti-Retinol Binding Protein-1 (RBP1) Monoclonal Antibody |
M03820 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Mouse Monoclonal Retinol Binding Protein-1 (RBP1) Antibody. Validated in IHC and tested in Goat, Human, Monkey, Mouse, Rabbit, Rat. |
Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7 |
4-PAA400Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RBP1 (Pro2~Gln135)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7. |
RBP1 sgRNA CRISPR Lentivector set (Human) |
K1800701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rbp1 sgRNA CRISPR Lentivector set (Mouse) |
K4494601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rbp1 sgRNA CRISPR Lentivector set (Rat) |
K6840201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: SPM442 |
APG01249G |
Leading Biology |
7 ml |
EUR 484 |
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone SPM442. This antibody is applicable in IHC, IF |
Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: G4E4 |
APG01250G |
Leading Biology |
7 ml |
EUR 484 |
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone G4E4. This antibody is applicable in IHC, IF |
Monoclonal PAI-RBP1 Antibody (monoclonal) (M01), Clone: 1D2-2E9 |
AMM03877G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PAI-RBP1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1D2-2E9. This antibody is applicable in WB and IF |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RBP1 Rabbit Polyclonal Antibody