RBP1 Rabbit Polyclonal Antibody

RBP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBP1 Polyclonal Antibody
ABP60118-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RBP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
27262-100ul 100ul
EUR 252

RBP1 Polyclonal Antibody
27262-50ul 50ul
EUR 187

RBP1 Rabbit pAb
A10029-100ul 100 ul
EUR 308

RBP1 Rabbit pAb
A10029-200ul 200 ul
EUR 459

RBP1 Rabbit pAb
A10029-20ul 20 ul
EUR 183

RBP1 Rabbit pAb
A10029-50ul 50 ul
EUR 223

RBP1 Polyclonal Conjugated Antibody
C27262 100ul
EUR 397

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-48T 48T
EUR 479
  • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-96T 96T
EUR 621
  • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-48Tests 48 Tests
EUR 478

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-96Tests 96 Tests
EUR 662

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-48Tests 48 Tests
EUR 500

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-96Tests 96 Tests
EUR 692

Polyclonal Goat Anti-RBP1 Antibody
APG00276G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications:

RBP1 antibody
10R-5603 100 ul
EUR 726
Description: Mouse monoclonal RBP1 antibody

RBP1 antibody
10R-5604 100 ul
EUR 691
Description: Mouse monoclonal RBP1 antibody

RBP1 antibody
70R-12616 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-12617 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-1274 100 ug
EUR 377
Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1

RBP1 Antibody
1-CSB-PA019480GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RBP1 Antibody
1-CSB-PA019480YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal RBP1 / CRBP Antibody (C-Terminus)
APG01059G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- RBP1 antibody
FNab07188 100µg
EUR 585
  • Immunogen: retinol binding protein 1, cellular
  • Uniprot ID: P09455
  • Gene ID: 5947
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against RBP1

Anti-RBP1 antibody
PAab07188 100 ug
EUR 412

Anti-RBP1 antibody
STJ70670 100 µg
EUR 359

Anti-RBP1 antibody
STJ112069 100 µl
EUR 277
Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-RBP1 antibody
STJ193046 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBP1

Rbp1/ Rat Rbp1 ELISA Kit
ELI-04007r 96 Tests
EUR 886

RBP1 siRNA
20-abx904510
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBP1 siRNA
20-abx931119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBP1 siRNA
20-abx931120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBP1 Antibody, HRP conjugated
1-CSB-PA019480YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBP1 Antibody, FITC conjugated
1-CSB-PA019480YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBP1 Antibody, Biotin conjugated
1-CSB-PA019480YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBP1 cloning plasmid
CSB-CL019480HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG
  • Show more
Description: A cloning plasmid for the RBP1 gene.

RBP1 Blocking Peptide
33R-4007 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine)
4-PAA400Bo01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse)
4-PAA400Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig)
4-PAA400Po01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat)
4-PAA400Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC
4-PAA400Bo01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated
4-PAA400Bo01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3
4-PAA400Bo01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC
4-PAA400Bo01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP
4-PAA400Bo01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE
4-PAA400Bo01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC
4-PAA400Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA400Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3
4-PAA400Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC
4-PAA400Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP
4-PAA400Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE
4-PAA400Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC
4-PAA400Po01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated
4-PAA400Po01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3
4-PAA400Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC
4-PAA400Po01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP
4-PAA400Po01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE
4-PAA400Po01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC
4-PAA400Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated
4-PAA400Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3
4-PAA400Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC
4-PAA400Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP
4-PAA400Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE
4-PAA400Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol-Binding Protein 1 (Rbp1) Antibody
20-abx116773
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
20-abx135947
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx433219-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx237188-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Rat RBP1 shRNA Plasmid
20-abx984766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RBP1 ELISA Kit
ELA-E1209h 96 Tests
EUR 824

RBP1 ELISA KIT|Human
EF004456 96 Tests
EUR 689

Human RBP1 shRNA Plasmid
20-abx954026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBP1 protein (His tag)
80R-2045 50 ug
EUR 322
Description: Recombinant human RBP1 protein (His tag)

Mouse RBP1 shRNA Plasmid
20-abx972405
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBP1 Recombinant Protein (Human)
RP042796 100 ug Ask for price

RBP1 Recombinant Protein (Rat)
RP223892 100 ug Ask for price

RBP1 Recombinant Protein (Mouse)
RP167303 100 ug Ask for price

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC-Cy7
4-PAA400Bo01-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Met1~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig)
4-PAA400Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA400Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC-Cy7
4-PAA400Po01-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Asn135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA400Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~His135)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein-1(RBP1/872) Antibody
BNC610872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC610872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC400872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC400872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC430872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC430872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC470872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC470872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC050872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC050872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-100 100uL
EUR 209
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-500 500uL
EUR 458
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUM0872-50 50uL
EUR 395
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), 1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC680872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC680872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC700872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC700872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC940872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC940872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCH0872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCH0872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC800872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC800872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCP0872-250 250uL
EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), PerCP conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCR0872-250 250uL
EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), RPE conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCA0872-250 250uL
EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), APC conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCAP0872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCAP0872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCB0872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCB0872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC880872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC880872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC810872-100 100uL
EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC810872-500 500uL
EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx128517
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx129519
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx130157
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103757
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103758
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx174395
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-p40 Antibody Clone, Unconjugated-100ug
8626-RBP1-P1 100ug
EUR 428

Anti-beta-Catenin Antibody Clone, Unconjugated-100ug
1499-RBP1-P1 100ug
EUR 428

Anti-TIMP-3 Antibody Clone, Unconjugated-100ug
7078-RBP1-P1 100ug
EUR 428

Anti-Helicobacter Pylori Antibody Clone, Unconjugated-100ug
RBP1-374-P1 100ug
EUR 377

Rbp1 ORF Vector (Rat) (pORF)
ORF074632 1.0 ug DNA
EUR 506

RBP1 ORF Vector (Human) (pORF)
ORF014266 1.0 ug DNA
EUR 354

Rbp1 ORF Vector (Mouse) (pORF)
ORF055769 1.0 ug DNA
EUR 506

RBP1 ELISA Kit (Human) (OKAN05290)
OKAN05290 96 Wells
EUR 792
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

RBP1 ELISA Kit (Human) (OKCD06311)
OKCD06311 96 Wells
EUR 753
Description: Description of target: RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision.RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. The gene harbors four exons encoding 24, 59, 33, and 16 amino acid residues respectively. The second intervening sequence alone occupies 19 kb of the 21 kb of the gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

RBP1 ELISA Kit (Human) (OKEH00871)
OKEH00871 96 Wells
EUR 662
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.53 ng/mL

RBP1 ELISA Kit (Rat) (OKEH00872)
OKEH00872 96 Wells
EUR 662
Description: Description of target: binds and transports retinol; plays a role in vitamin A metabolism [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.406 ng/mL

Rbp1 ELISA Kit (Mouse) (OKEH04661)
OKEH04661 96 Wells
EUR 1014
Description: Description of target: Intracellular transport of retinol.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.785 ng/mL

RBP1 ELISA Kit (Bovine) (OKEH07808)
OKEH07808 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32ng/mL

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAA400Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAA400Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAA400Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAA400Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAA400Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAA400Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Monoclonal RBP1 / CRBP Antibody (clone 2E1), Clone: 2E1
AMM02236G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human RBP1 / CRBP (clone 2E1). The antibodies are raised in Mouse and are from clone 2E1. This antibody is applicable in WB and IHC-P, IF, Flo

Retinol Binding Protein 1, Cellular (RBP1) Antibody (Biotin)
20-abx273472
  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Anti-Retinol Binding Protein-1 (RBP1) Monoclonal Antibody
M03820 100ug/vial
EUR 397
Description: Mouse Monoclonal Retinol Binding Protein-1 (RBP1) Antibody. Validated in IHC and tested in Goat, Human, Monkey, Mouse, Rabbit, Rat.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAA400Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RBP1 (Pro2~Gln135)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

RBP1 sgRNA CRISPR Lentivector set (Human)
K1800701 3 x 1.0 ug
EUR 339

Rbp1 sgRNA CRISPR Lentivector set (Mouse)
K4494601 3 x 1.0 ug
EUR 339

Rbp1 sgRNA CRISPR Lentivector set (Rat)
K6840201 3 x 1.0 ug
EUR 339

Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: SPM442
APG01249G 7 ml
EUR 484
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone SPM442. This antibody is applicable in IHC, IF

Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: G4E4
APG01250G 7 ml
EUR 484
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone G4E4. This antibody is applicable in IHC, IF

Monoclonal PAI-RBP1 Antibody (monoclonal) (M01), Clone: 1D2-2E9
AMM03877G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PAI-RBP1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1D2-2E9. This antibody is applicable in WB and IF

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RBP1 Rabbit Polyclonal Antibody