RBP1 Rabbit Polyclonal Antibody

RBP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBP1 Polyclonal Antibody
ABP60118-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ES11888-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBP1 Polyclonal Antibody
ES11888-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBP1 Rabbit pAb
A10029-100ul	Abclonal	100 ul	EUR 308

RBP1 Rabbit pAb
A10029-200ul	Abclonal	200 ul	EUR 459

RBP1 Rabbit pAb
A10029-20ul	Abclonal	20 ul	EUR 183

RBP1 Rabbit pAb
A10029-50ul	Abclonal	50 ul	EUR 223

RBP1 Polyclonal Conjugated Antibody
C27262	SAB	100ul	EUR 397

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Polyclonal Goat Anti-RBP1 Antibody
APG00276G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications:

RBP1 antibody
70R-12616	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-12617	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-1274	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1

RBP1 antibody
10R-5603	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal RBP1 antibody

RBP1 antibody
10R-5604	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RBP1 antibody

RBP1 Antibody
1-CSB-PA019480GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RBP1 Antibody
1-CSB-PA019480YA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal RBP1 / CRBP Antibody (C-Terminus)
APG01059G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- RBP1 antibody
FNab07188	FN Test	100µg	EUR 585
Immunogen: retinol binding protein 1, cellular Uniprot ID: P09455 Gene ID: 5947 Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against RBP1

Anti-RBP1 antibody
PAab07188	Lifescience Market	100 ug	EUR 412

Anti-RBP1 antibody
STJ112069	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-RBP1 antibody
STJ193046	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RBP1

Anti-RBP1 antibody
STJ70670	St John's Laboratory	100 µg	EUR 359

Rbp1/ Rat Rbp1 ELISA Kit
ELI-04007r	Lifescience Market	96 Tests	EUR 886

RBP1 siRNA
20-abx904510	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 siRNA
20-abx931119	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 siRNA
20-abx931120	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 Antibody, HRP conjugated
1-CSB-PA019480YB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBP1 Antibody, FITC conjugated
1-CSB-PA019480YC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBP1 Antibody, Biotin conjugated
1-CSB-PA019480YD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBP1 Blocking Peptide
33R-4007	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274

RBP1 cloning plasmid
CSB-CL019480HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 408 Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG Show more
Description: A cloning plasmid for the RBP1 gene.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine)
4-PAA400Bo01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse)
4-PAA400Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig)
4-PAA400Po01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat)
4-PAA400Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC
4-PAA400Bo01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated
4-PAA400Bo01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3
4-PAA400Bo01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC
4-PAA400Bo01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP
4-PAA400Bo01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE
4-PAA400Bo01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC
4-PAA400Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA400Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3
4-PAA400Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC
4-PAA400Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP
4-PAA400Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE
4-PAA400Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC
4-PAA400Po01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated
4-PAA400Po01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3
4-PAA400Po01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC
4-PAA400Po01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP
4-PAA400Po01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE
4-PAA400Po01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC
4-PAA400Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated
4-PAA400Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3
4-PAA400Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC
4-PAA400Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP
4-PAA400Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE
4-PAA400Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol-Binding Protein 1 (Rbp1) Antibody
20-abx116773	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
20-abx135947	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx237188-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx433219-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

RBP1 protein (His tag)
80R-2045	Fitzgerald	50 ug	EUR 322
Description: Recombinant human RBP1 protein (His tag)

Human RBP1 ELISA Kit
ELA-E1209h	Lifescience Market	96 Tests	EUR 824

RBP1 ELISA KIT|Human
EF004456	Lifescience Market	96 Tests	EUR 689

Mouse RBP1 shRNA Plasmid
20-abx972405	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RBP1 shRNA Plasmid
20-abx984766	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RBP1 shRNA Plasmid
20-abx954026	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RBP1 Recombinant Protein (Human)
RP042796	ABM	100 ug	Ask for price

RBP1 Recombinant Protein (Mouse)
RP167303	ABM	100 ug	Ask for price

RBP1 Recombinant Protein (Rat)
RP223892	ABM	100 ug	Ask for price

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC-Cy7
4-PAA400Bo01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig)
4-PAA400Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA400Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC-Cy7
4-PAA400Po01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA400Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103757	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103758	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx128517	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx129519	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx130157	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx174395	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Retinol Binding Protein-1(RBP1/872) Antibody
BNUM0872-50	Biotium	50uL	EUR 395
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), 1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-100	Biotium	100uL	EUR 209
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-500	Biotium	500uL	EUR 458
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC610872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC610872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF660R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC470872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC470872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF647 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC050872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC050872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405M conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC400872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC400872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF640R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC430872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC430872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF543 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC800872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC800872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCP0872-250	Biotium	250uL	EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), PerCP conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCR0872-250	Biotium	250uL	EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), RPE conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCA0872-250	Biotium	250uL	EUR 383
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), APC conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCAP0872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCAP0872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCB0872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCB0872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Biotin conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCH0872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNCH0872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC880872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC880872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF488A conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC940872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC940872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF594 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC680872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC680872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF568 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC700872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC700872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF770 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC810872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC810872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF680R conjugate, Concentration: 0.1mg/mL

Anti-p40 Antibody Clone, Unconjugated-100ug
8626-RBP1-P1	EnQuireBio	100ug	EUR 428

Anti-TIMP-3 Antibody Clone, Unconjugated-100ug
7078-RBP1-P1	EnQuireBio	100ug	EUR 428

Anti-beta-Catenin Antibody Clone, Unconjugated-100ug
1499-RBP1-P1	EnQuireBio	100ug	EUR 428

Anti-Helicobacter Pylori Antibody Clone, Unconjugated-100ug
RBP1-374-P1	EnQuireBio	100ug	EUR 377

Rbp1 ORF Vector (Rat) (pORF)
ORF074632	ABM	1.0 ug DNA	EUR 506

RBP1 ORF Vector (Human) (pORF)
ORF014266	ABM	1.0 ug DNA	EUR 354

Rbp1 ORF Vector (Mouse) (pORF)
ORF055769	ABM	1.0 ug DNA	EUR 506

RBP1 ELISA Kit (Human) (OKAN05290)
OKAN05290	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

RBP1 ELISA Kit (Human) (OKCD06311)
OKCD06311	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision.RBP1 is the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. The gene harbors four exons encoding 24, 59, 33, and 16 amino acid residues respectively. The second intervening sequence alone occupies 19 kb of the 21 kb of the gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

RBP1 ELISA Kit (Human) (OKEH00871)
OKEH00871	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.53 ng/mL

RBP1 ELISA Kit (Rat) (OKEH00872)
OKEH00872	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: binds and transports retinol; plays a role in vitamin A metabolism [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.406 ng/mL

RBP1 ELISA Kit (Bovine) (OKEH07808)
OKEH07808	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32ng/mL

Rbp1 ELISA Kit (Mouse) (OKEH04661)
OKEH04661	Aviva Systems Biology	96 Wells	EUR 1014
Description: Description of target: Intracellular transport of retinol.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.785 ng/mL

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAA400Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAA400Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAA400Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAA400Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAA400Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAA400Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Antibody (Biotin)
20-abx273472	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Monoclonal RBP1 / CRBP Antibody (clone 2E1), Clone: 2E1
AMM02236G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human RBP1 / CRBP (clone 2E1). The antibodies are raised in Mouse and are from clone 2E1. This antibody is applicable in WB and IHC-P, IF, Flo

Anti-Retinol Binding Protein-1 (RBP1) Monoclonal Antibody
M03820	BosterBio	100ug/vial	EUR 397
Description: Mouse Monoclonal Retinol Binding Protein-1 (RBP1) Antibody. Validated in IHC and tested in Goat, Human, Monkey, Mouse, Rabbit, Rat.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAA400Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Rbp1 sgRNA CRISPR Lentivector set (Rat)
K6840201	ABM	3 x 1.0 ug	EUR 339

RBP1 sgRNA CRISPR Lentivector set (Human)
K1800701	ABM	3 x 1.0 ug	EUR 339

Rbp1 sgRNA CRISPR Lentivector set (Mouse)
K4494601	ABM	3 x 1.0 ug	EUR 339

Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: SPM442
APG01249G	Leading Biology	7 ml	EUR 484
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone SPM442. This antibody is applicable in IHC, IF

Monoclonal Retinol Binding Protein-1 (RBP1) Antibody, Clone: G4E4
APG01250G	Leading Biology	7 ml	EUR 484
Description: A Monoclonal antibody against Human Retinol Binding Protein-1 (RBP1). The antibodies are raised in Mouse and are from clone G4E4. This antibody is applicable in IHC, IF

Monoclonal PAI-RBP1 Antibody (monoclonal) (M01), Clone: 1D2-2E9
AMM03877G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PAI-RBP1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1D2-2E9. This antibody is applicable in WB and IF

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

RBP1 Rabbit Polyclonal Antibody