RBP1 Rabbit Polyclonal Antibody

RBP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBP1 Polyclonal Antibody
ABP60118-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ABP60118-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RBP1 protein Applications tips:
Description: A polyclonal antibody for detection of RBP1 from Human, Mouse, Rat. This RBP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBP1 protein

RBP1 Polyclonal Antibody
ES11888-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBP1 Polyclonal Antibody
ES11888-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBP1 Rabbit pAb
A10029-100ul	Abclonal	100 ul	EUR 308

RBP1 Rabbit pAb
A10029-200ul	Abclonal	200 ul	EUR 459

RBP1 Rabbit pAb
A10029-20ul	Abclonal	20 ul	EUR 183

RBP1 Rabbit pAb
A10029-50ul	Abclonal	50 ul	EUR 223

RBP1 Polyclonal Conjugated Antibody
C27262	SAB	100ul	EUR 397

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
DLR-RBP1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RDR-RBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
RD-RBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Polyclonal Goat Anti-RBP1 Antibody
APG00276G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications:

RBP1 antibody
70R-12616	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-12617	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal RBP1 antibody

RBP1 antibody
70R-1274	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1

RBP1 antibody
10R-5603	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal RBP1 antibody

RBP1 antibody
10R-5604	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal RBP1 antibody

RBP1 Antibody
1-CSB-PA019480GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RBP1 Antibody
1-CSB-PA019480YA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal RBP1 / CRBP Antibody (C-Terminus)
APG01059G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- RBP1 antibody
FNab07188	FN Test	100µg	EUR 585
Immunogen: retinol binding protein 1, cellular Uniprot ID: P09455 Gene ID: 5947 Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against RBP1

Anti-RBP1 antibody
PAab07188	Lifescience Market	100 ug	EUR 412

Anti-RBP1 antibody
STJ112069	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-RBP1 antibody
STJ193046	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RBP1

Anti-RBP1 antibody
STJ70670	St John's Laboratory	100 µg	EUR 359

Rbp1/ Rat Rbp1 ELISA Kit
ELI-04007r	Lifescience Market	96 Tests	EUR 886

RBP1 siRNA
20-abx904510	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 siRNA
20-abx931119	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 siRNA
20-abx931120	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBP1 Antibody, HRP conjugated
1-CSB-PA019480YB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBP1 Antibody, FITC conjugated
1-CSB-PA019480YC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBP1 Antibody, Biotin conjugated
1-CSB-PA019480YD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBP1 Blocking Peptide
33R-4007	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274

RBP1 cloning plasmid
CSB-CL019480HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 408 Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG Show more
Description: A cloning plasmid for the RBP1 gene.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine)
4-PAA400Bo01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse)
4-PAA400Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig)
4-PAA400Po01	Cloud-Clone	EUR 259.00 EUR 2694.00 EUR 667.00 EUR 326.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat)
4-PAA400Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC
4-PAA400Bo01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated
4-PAA400Bo01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3
4-PAA400Bo01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC
4-PAA400Bo01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP
4-PAA400Bo01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE
4-PAA400Bo01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC
4-PAA400Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA400Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3
4-PAA400Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC
4-PAA400Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP
4-PAA400Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE
4-PAA400Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC
4-PAA400Po01-APC	Cloud-Clone	EUR 363.00 EUR 3527.00 EUR 975.00 EUR 465.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated
4-PAA400Po01-Biotin	Cloud-Clone	EUR 324.00 EUR 2644.00 EUR 773.00 EUR 399.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3
4-PAA400Po01-Cy3	Cloud-Clone	EUR 443.00 EUR 4661.00 EUR 1259.00 EUR 578.00 EUR 260.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC
4-PAA400Po01-FITC	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP
4-PAA400Po01-HRP	Cloud-Clone	EUR 331.00 EUR 3073.00 EUR 862.00 EUR 419.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE
4-PAA400Po01-PE	Cloud-Clone	EUR 310.00 EUR 2841.00 EUR 800.00 EUR 392.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC
4-PAA400Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated
4-PAA400Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3
4-PAA400Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC
4-PAA400Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP
4-PAA400Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE
4-PAA400Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.

Retinol-Binding Protein 1 (Rbp1) Antibody
20-abx116773	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
20-abx135947	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx237188-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Retinol-Binding Protein 1 (RBP1) Antibody
abx433219-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

RBP1 protein (His tag)
80R-2045	Fitzgerald	50 ug	EUR 322
Description: Recombinant human RBP1 protein (His tag)

Human RBP1 ELISA Kit
ELA-E1209h	Lifescience Market	96 Tests	EUR 824

RBP1 ELISA KIT|Human
EF004456	Lifescience Market	96 Tests	EUR 689

Mouse RBP1 shRNA Plasmid
20-abx972405	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RBP1 shRNA Plasmid
20-abx984766	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RBP1 shRNA Plasmid
20-abx954026	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RBP1 Recombinant Protein (Human)
RP042796	ABM	100 ug	Ask for price

RBP1 Recombinant Protein (Mouse)
RP167303	ABM	100 ug	Ask for price

RBP1 Recombinant Protein (Rat)
RP223892	ABM	100 ug	Ask for price

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC-Cy7
4-PAA400Bo01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Met1~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Human, Rat, Pig)
4-PAA400Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Gln135) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Retinol Binding Protein 1, Cellular (RBP1)

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA400Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC-Cy7
4-PAA400Po01-APC-Cy7	Cloud-Clone	EUR 607.00 EUR 6934.00 EUR 1831.00 EUR 810.00 EUR 333.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~Asn135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA400Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RBP1 (Pro2~His135) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC-Cy7.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103757	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx103758	Abbexa	EUR 453.00 EUR 133.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx128517	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx129519	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx130157	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Retinol Binding Protein 1, Cellular (RBP1) Antibody
20-abx174395	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Retinol Binding Protein-1(RBP1/872) Antibody
BNUM0872-50	Biotium	50uL	EUR 395
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), 1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-100	Biotium	100uL	EUR 209
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNUB0872-500	Biotium	500uL	EUR 458
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), Concentration: 0.2mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC040872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF405S conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-100	Biotium	100uL	EUR 199
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

Retinol Binding Protein-1(RBP1/872) Antibody
BNC550872-500	Biotium	500uL	EUR 544
Description: Primary antibody against Retinol Binding Protein-1(RBP1/872), CF555 conjugate, Concentration: 0.1mg/mL

RBP1 Rabbit Polyclonal Antibody