NPSR1 Rabbit Polyclonal Antibody

NPSR1 Rabbit Polyclonal Antibody

To Order Now:

NPSR1 Polyclonal Antibody

29919-100ul 100ul
EUR 252

NPSR1 Polyclonal Antibody

29919-50ul 50ul
EUR 187

NPSR1 Polyclonal Antibody

ABP59509-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NPSR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NPSR1 from Human, Mouse, Rat. This NPSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NPSR1 protein

NPSR1 Polyclonal Antibody

ABP59509-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NPSR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NPSR1 from Human, Mouse, Rat. This NPSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NPSR1 protein

NPSR1 Polyclonal Antibody

ABP59509-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NPSR1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NPSR1 from Human, Mouse, Rat. This NPSR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NPSR1 protein

NPSR1 Polyclonal Antibody

ES11509-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NPSR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NPSR1 Polyclonal Antibody

ES11509-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NPSR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NPSR1 Rabbit pAb

A16618-100ul 100 ul
EUR 308

NPSR1 Rabbit pAb

A16618-200ul 200 ul
EUR 459

NPSR1 Rabbit pAb

A16618-20ul 20 ul
EUR 183

NPSR1 Rabbit pAb

A16618-50ul 50 ul
EUR 223

NPSR1 Rabbit pAb

A16619-100ul 100 ul
EUR 308

NPSR1 Rabbit pAb

A16619-200ul 200 ul
EUR 459

NPSR1 Rabbit pAb

A16619-20ul 20 ul
EUR 183

NPSR1 Rabbit pAb

A16619-50ul 50 ul
EUR 223

NPSR1 Polyclonal Conjugated Antibody

C29918 100ul
EUR 397

NPSR1 Polyclonal Conjugated Antibody

C29919 100ul
EUR 397

NPSR1 Antibody

39424-100ul 100ul
EUR 390

NPSR1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NPSR1 Antibody

DF2822 200ul
EUR 304
Description: NPSR1 antibody detects endogenous levels of total NPSR1.

NPSR1 Antibody

ABD2822 100 ug
EUR 438

Npsr1/ Rat Npsr1 ELISA Kit

ELI-23684r 96 Tests
EUR 886

Anti-NPSR1 antibody

STJ119056 100 µl
EUR 277

Anti-NPSR1 antibody

STJ119057 100 µl
EUR 277

Anti-NPSR1 antibody

STJ192667 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NPSR1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27050 50 ul
EUR 334
Description: Mouse polyclonal to NPSR1

Polyclonal NPSR1 / NPSR / GPR154 Antibody (Extracellular Domain)

AMM06796G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NPSR1 / NPSR / GPR154 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

NPSR1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NPSR1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NPSR1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NPSR1. Recognizes NPSR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NPSR1 Blocking Peptide

DF2822-BP 1mg
EUR 195

NPSR1 cloning plasmid

CSB-CL757818HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgccagccaacttcacagagggcagcttcgattccagtgggaccgggcagacgctggattcttccccagtggcttgcactgaaacagtgacttttactgaagtggtggaaggaaaggaatggggttccttctactactcctttaagactgagcaattgataactctgtgggtcc
  • Show more
Description: A cloning plasmid for the NPSR1 gene.

Anti-NPSR1 (2F5)

YF-MA20144 100 ug
EUR 363
Description: Mouse monoclonal to NPSR1

Neuropeptide S Receptor (NPSR1) Antibody

abx037670-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropeptide S Receptor (NPSR1) Antibody

abx037671-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropeptide S Receptor (NPSR1) Antibody

abx038292-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropeptide S Receptor (NPSR1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF005346 96 Tests
EUR 689

Human NPSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NPSR1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPSR1 Recombinant Protein (Human)

RP041731 100 ug Ask for price

NPSR1 Recombinant Protein (Mouse)

RP154781 100 ug Ask for price

NPSR1 Recombinant Protein (Rat)

RP214385 100 ug Ask for price

Neuropeptide S Receptor (NPSR1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropeptide S Receptor (NPSR1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropeptide S Receptor (NPSR1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Npsr1 ORF Vector (Rat) (pORF)

ORF071463 1.0 ug DNA
EUR 506

NPSR1 ORF Vector (Human) (pORF)

ORF013911 1.0 ug DNA
EUR 354

Npsr1 ORF Vector (Mouse) (pORF)

ORF051595 1.0 ug DNA
EUR 506

Npsr1 sgRNA CRISPR Lentivector set (Rat)

K6707801 3 x 1.0 ug
EUR 339

Npsr1 sgRNA CRISPR Lentivector set (Mouse)

K3616501 3 x 1.0 ug
EUR 339

NPSR1 sgRNA CRISPR Lentivector set (Human)

K1449801 3 x 1.0 ug
EUR 339

NPSR1-AS1 ORF Vector (Human) (pORF)

ORF026238 1.0 ug DNA Ask for price

Human Neuropeptide S receptor(NPSR1) ELISA kit

CSB-EL016027HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor (NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuropeptide S receptor(NPSR1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropeptide S receptor(NPSR1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neuropeptide S receptor, NPSR1 ELISA KIT

ELI-14847h 96 Tests
EUR 824

Mouse Neuropeptide S receptor, Npsr1 ELISA KIT

ELI-22107m 96 Tests
EUR 865

Rat Neuropeptide S receptor (NPSR1) ELISA Kit

abx391701-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NPSR1 Rabbit Polyclonal Antibody