THYN1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
THYN1 Polyclonal Antibody |
ABP60678-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human THYN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of THYN1 from Human, Mouse, Rat. This THYN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THYN1 protein |
THYN1 antibody |
70R-3715 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal THYN1 antibody raised against the middle region of THYN1 |
THYN1 antibody |
70R-4037 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal THYN1 antibody raised against the N terminal of THYN1 |
THYN1 antibody |
70R-20818 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal THYN1 antibody |
THYN1 Antibody |
40147-100ul |
SAB |
100ul |
EUR 252 |
THYN1 Antibody |
1-CSB-PA693156 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
THYN1 Antibody |
1-CSB-PA187498 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
THYN1 Antibody |
1-CSB-PA023526GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
THYN1 Conjugated Antibody |
C40147 |
SAB |
100ul |
EUR 397 |
anti- THYN1 antibody |
FNab08682 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: thymocyte nuclear protein 1
- Uniprot ID: Q9P016
- Gene ID: 29087
- Research Area: Cell Division and Proliferation, Cancer
|
Description: Antibody raised against THYN1 |
Human THYN1 Antibody |
32297-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-THYN1 antibody |
STJ192959 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to THYN1 |
THYN1 siRNA |
20-abx905570 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THYN1 siRNA |
20-abx936748 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THYN1 siRNA |
20-abx936749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human) |
4-PAC791Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1) |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat) |
4-PAC791Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1) |
THYN1 cloning plasmid |
CSB-CL023526HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 501
- Sequence: atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgat
- Show more
|
Description: A cloning plasmid for the THYN1 gene. |
THYN1 Blocking Peptide |
33R-6487 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-4037 |
THYN1 Blocking Peptide |
33R-6820 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-3715 |
Human THYN1 Antibody (Biotin Conjugate) |
32297-05121 |
AssayPro |
150 ug |
EUR 369 |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC |
4-PAC791Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Biotinylated |
4-PAC791Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Cy3 |
4-PAC791Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), FITC |
4-PAC791Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), HRP |
4-PAC791Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), PE |
4-PAC791Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC |
4-PAC791Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Biotinylated |
4-PAC791Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Cy3 |
4-PAC791Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), FITC |
4-PAC791Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), HRP |
4-PAC791Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), PE |
4-PAC791Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE. |
Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit |
E04T0692-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit |
E04T0692-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit |
E04T0692-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
20-abx116090 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
20-abx131638 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
20-abx131639 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
20-abx339588 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
abx238682-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Thymocyte Nuclear Protein 1 (THYN1) Antibody |
20-abx211306 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human THYN1 AssayLite Antibody (FITC Conjugate) |
32297-05141 |
AssayPro |
150 ug |
EUR 428 |
Human THYN1 AssayLite Antibody (RPE Conjugate) |
32297-05151 |
AssayPro |
150 ug |
EUR 428 |
Human THYN1 AssayLite Antibody (APC Conjugate) |
32297-05161 |
AssayPro |
150 ug |
EUR 428 |
Human THYN1 AssayLite Antibody (PerCP Conjugate) |
32297-05171 |
AssayPro |
150 ug |
EUR 471 |
Mouse THYN1 shRNA Plasmid |
20-abx978838 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat THYN1 shRNA Plasmid |
20-abx989056 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human THYN1 shRNA Plasmid |
20-abx959180 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
THYN1 protein (His tag) |
80R-1522 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human THYN1 protein |
THYN1 Recombinant Protein (Human) |
RP031534 |
ABM |
100 ug |
Ask for price |
THYN1 Recombinant Protein (Rat) |
RP233099 |
ABM |
100 ug |
Ask for price |
THYN1 Recombinant Protein (Mouse) |
RP178676 |
ABM |
100 ug |
Ask for price |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC791Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser225)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7. |
Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC791Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THYN1 (Met1~Ser226)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7. |
Thyn1 ORF Vector (Mouse) (pORF) |
ORF059560 |
ABM |
1.0 ug DNA |
EUR 506 |
THYN1 ORF Vector (Human) (pORF) |
ORF010512 |
ABM |
1.0 ug DNA |
EUR 95 |
Thyn1 ORF Vector (Rat) (pORF) |
ORF077701 |
ABM |
1.0 ug DNA |
EUR 506 |
THYN1 sgRNA CRISPR Lentivector set (Human) |
K2372401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Thyn1 sgRNA CRISPR Lentivector set (Mouse) |
K4954201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Thyn1 sgRNA CRISPR Lentivector set (Rat) |
K7166101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Thymocyte Nuclear Protein 1 (THYN1) |
4-RPC791Hu01 |
Cloud-Clone |
-
EUR 386.72
-
EUR 206.00
-
EUR 1175.20
-
EUR 458.40
-
EUR 816.80
-
EUR 322.00
-
EUR 2788.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9P016
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Thymocyte Nuclear Protein 1 expressed in: E.coli |
Recombinant Thymocyte Nuclear Protein 1 (THYN1) |
4-RPC791Ra01 |
Cloud-Clone |
-
EUR 440.48
-
EUR 221.00
-
EUR 1376.80
-
EUR 525.60
-
EUR 951.20
-
EUR 358.00
-
EUR 3292.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q6P3E0
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Thymocyte Nuclear Protein 1 expressed in: E.coli |
Human Thymocyte Nuclear Protein 1 (THYN1) Protein |
20-abx650181 |
Abbexa |
-
EUR 551.00
-
EUR 244.00
-
EUR 1595.00
-
EUR 648.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Thymocyte Nuclear Protein 1 (THYN1) Protein |
20-abx650182 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1859.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
THYN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2372402 |
ABM |
1.0 ug DNA |
EUR 154 |
THYN1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2372403 |
ABM |
1.0 ug DNA |
EUR 154 |
THYN1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2372404 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4954202 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4954203 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4954204 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7166102 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7166103 |
ABM |
1.0 ug DNA |
EUR 154 |
Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7166104 |
ABM |
1.0 ug DNA |
EUR 154 |
THYN1 Protein Vector (Human) (pPB-C-His) |
PV042045 |
ABM |
500 ng |
EUR 329 |
THYN1 Protein Vector (Human) (pPB-N-His) |
PV042046 |
ABM |
500 ng |
EUR 329 |
THYN1 Protein Vector (Human) (pPM-C-HA) |
PV042047 |
ABM |
500 ng |
EUR 329 |
THYN1 Protein Vector (Human) (pPM-C-His) |
PV042048 |
ABM |
500 ng |
EUR 329 |
Recombinant Human THYN1 Protein, His, E.coli-1mg |
QP13747-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human THYN1 Protein, His, E.coli-20ug |
QP13747-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human THYN1 Protein, His, E.coli-5ug |
QP13747-5ug |
EnQuireBio |
5ug |
EUR 155 |
THYN1 Protein Vector (Rat) (pPB-C-His) |
PV310802 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Rat) (pPB-N-His) |
PV310803 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Rat) (pPM-C-HA) |
PV310804 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Rat) (pPM-C-His) |
PV310805 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Mouse) (pPB-C-His) |
PV238238 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Mouse) (pPB-N-His) |
PV238239 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Mouse) (pPM-C-HA) |
PV238240 |
ABM |
500 ng |
EUR 603 |
THYN1 Protein Vector (Mouse) (pPM-C-His) |
PV238241 |
ABM |
500 ng |
EUR 603 |
Thyn1 3'UTR GFP Stable Cell Line |
TU170479 |
ABM |
1.0 ml |
Ask for price |
THYN1 3'UTR GFP Stable Cell Line |
TU075565 |
ABM |
1.0 ml |
EUR 1394 |
Thyn1 3'UTR Luciferase Stable Cell Line |
TU120479 |
ABM |
1.0 ml |
Ask for price |
THYN1 3'UTR Luciferase Stable Cell Line |
TU025565 |
ABM |
1.0 ml |
EUR 1394 |
Thyn1 3'UTR Luciferase Stable Cell Line |
TU221879 |
ABM |
1.0 ml |
Ask for price |
Thyn1 3'UTR GFP Stable Cell Line |
TU271879 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
THYN1 Rabbit Polyclonal Antibody