THYN1 Rabbit Polyclonal Antibody

THYN1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

THYN1 Polyclonal Antibody
ABP60678-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human THYN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of THYN1 from Human, Mouse, Rat. This THYN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THYN1 protein

THYN1 antibody
70R-3715 50 ug
EUR 467
Description: Rabbit polyclonal THYN1 antibody raised against the middle region of THYN1

THYN1 antibody
70R-4037 50 ug
EUR 467
Description: Rabbit polyclonal THYN1 antibody raised against the N terminal of THYN1

THYN1 antibody
70R-20818 50 ul
EUR 435
Description: Rabbit polyclonal THYN1 antibody

THYN1 Antibody
40147-100ul 100ul
EUR 252

THYN1 Antibody
1-CSB-PA693156
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

THYN1 Antibody
1-CSB-PA187498
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

THYN1 Antibody
1-CSB-PA023526GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

THYN1 Conjugated Antibody
C40147 100ul
EUR 397

anti- THYN1 antibody
FNab08682 100µg
EUR 548.75
  • Immunogen: thymocyte nuclear protein 1
  • Uniprot ID: Q9P016
  • Gene ID: 29087
  • Research Area: Cell Division and Proliferation, Cancer
Description: Antibody raised against THYN1

Human THYN1 Antibody
32297-05111 150 ug
EUR 261

Anti-THYN1 antibody
PAab08682 100 ug
EUR 386

Anti-THYN1 antibody
STJ192959 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to THYN1

Thyn1/ Rat Thyn1 ELISA Kit
ELI-52045r 96 Tests
EUR 886

THYN1 siRNA
20-abx905570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THYN1 siRNA
20-abx936748
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

THYN1 siRNA
20-abx936749
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human)
4-PAC791Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1)

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat)
4-PAC791Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1)

THYN1 cloning plasmid
CSB-CL023526HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 501
  • Sequence: atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgat
  • Show more
Description: A cloning plasmid for the THYN1 gene.

THYN1 Blocking Peptide
33R-6487 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-4037

THYN1 Blocking Peptide
33R-6820 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-3715

Human THYN1 Antibody (Biotin Conjugate)
32297-05121 150 ug
EUR 369

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC
4-PAC791Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Biotinylated
4-PAC791Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Cy3
4-PAC791Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), FITC
4-PAC791Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), HRP
4-PAC791Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), PE
4-PAC791Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC
4-PAC791Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Biotinylated
4-PAC791Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Cy3
4-PAC791Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), FITC
4-PAC791Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), HRP
4-PAC791Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), PE
4-PAC791Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx116090
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx131638
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx131639
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx339588
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
abx238682-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx211306
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human THYN1 AssayLite Antibody (FITC Conjugate)
32297-05141 150 ug
EUR 428

Human THYN1 AssayLite Antibody (RPE Conjugate)
32297-05151 150 ug
EUR 428

Human THYN1 AssayLite Antibody (APC Conjugate)
32297-05161 150 ug
EUR 428

Human THYN1 AssayLite Antibody (PerCP Conjugate)
32297-05171 150 ug
EUR 471

Mouse THYN1 shRNA Plasmid
20-abx978838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat THYN1 shRNA Plasmid
20-abx989056
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

THYN1 ELISA KIT|Human
EF003598 96 Tests
EUR 689

Human THYN1 shRNA Plasmid
20-abx959180
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

THYN1 protein (His tag)
80R-1522 100 ug
EUR 305
Description: Purified recombinant Human THYN1 protein

THYN1 Recombinant Protein (Human)
RP031534 100 ug Ask for price

THYN1 Recombinant Protein (Rat)
RP233099 100 ug Ask for price

THYN1 Recombinant Protein (Mouse)
RP178676 100 ug Ask for price

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC-Cy7
4-PAC791Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser225)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC791Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THYN1 (Met1~Ser226)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

Thyn1 ORF Vector (Mouse) (pORF)
ORF059560 1.0 ug DNA
EUR 506

THYN1 ORF Vector (Human) (pORF)
ORF010512 1.0 ug DNA
EUR 95

Thyn1 ORF Vector (Rat) (pORF)
ORF077701 1.0 ug DNA
EUR 506

THYN1 sgRNA CRISPR Lentivector set (Human)
K2372401 3 x 1.0 ug
EUR 339

Thyn1 sgRNA CRISPR Lentivector set (Mouse)
K4954201 3 x 1.0 ug
EUR 339

Thyn1 sgRNA CRISPR Lentivector set (Rat)
K7166101 3 x 1.0 ug
EUR 339

Recombinant Thymocyte Nuclear Protein 1 (THYN1)
4-RPC791Hu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9P016
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thymocyte Nuclear Protein 1 expressed in: E.coli

Recombinant Thymocyte Nuclear Protein 1 (THYN1)
4-RPC791Ra01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6P3E0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Thymocyte Nuclear Protein 1 expressed in: E.coli

Human Thymocyte Nuclear Protein 1 (THYN1) Protein
20-abx650181
  • EUR 551.00
  • EUR 244.00
  • EUR 1595.00
  • EUR 648.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Thymocyte Nuclear Protein 1 (THYN1) Protein
20-abx650182
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

THYN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2372402 1.0 ug DNA
EUR 154

THYN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2372403 1.0 ug DNA
EUR 154

THYN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2372404 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4954202 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4954203 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4954204 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7166102 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7166103 1.0 ug DNA
EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7166104 1.0 ug DNA
EUR 154

THYN1 Protein Vector (Human) (pPB-C-His)
PV042045 500 ng
EUR 329

THYN1 Protein Vector (Human) (pPB-N-His)
PV042046 500 ng
EUR 329

THYN1 Protein Vector (Human) (pPM-C-HA)
PV042047 500 ng
EUR 329

THYN1 Protein Vector (Human) (pPM-C-His)
PV042048 500 ng
EUR 329

Recombinant Human THYN1 Protein, His, E.coli-1mg
QP13747-1mg 1mg
EUR 2757

Recombinant Human THYN1 Protein, His, E.coli-20ug
QP13747-20ug 20ug
EUR 201

Recombinant Human THYN1 Protein, His, E.coli-5ug
QP13747-5ug 5ug
EUR 155

THYN1 Protein Vector (Rat) (pPB-C-His)
PV310802 500 ng
EUR 603

THYN1 Protein Vector (Rat) (pPB-N-His)
PV310803 500 ng
EUR 603

THYN1 Protein Vector (Rat) (pPM-C-HA)
PV310804 500 ng
EUR 603

THYN1 Protein Vector (Rat) (pPM-C-His)
PV310805 500 ng
EUR 603

THYN1 Protein Vector (Mouse) (pPB-C-His)
PV238238 500 ng
EUR 603

THYN1 Protein Vector (Mouse) (pPB-N-His)
PV238239 500 ng
EUR 603

THYN1 Protein Vector (Mouse) (pPM-C-HA)
PV238240 500 ng
EUR 603

THYN1 Protein Vector (Mouse) (pPM-C-His)
PV238241 500 ng
EUR 603

Thyn1 3'UTR GFP Stable Cell Line
TU170479 1.0 ml Ask for price

THYN1 3'UTR GFP Stable Cell Line
TU075565 1.0 ml
EUR 1394

Thyn1 3'UTR Luciferase Stable Cell Line
TU120479 1.0 ml Ask for price

THYN1 3'UTR Luciferase Stable Cell Line
TU025565 1.0 ml
EUR 1394

Thyn1 3'UTR Luciferase Stable Cell Line
TU221879 1.0 ml Ask for price

Thyn1 3'UTR GFP Stable Cell Line
TU271879 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

THYN1 Rabbit Polyclonal Antibody