THYN1 Rabbit Polyclonal Antibody

THYN1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

THYN1 Polyclonal Antibody
ABP60678-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human THYN1 protein Applications tips:
Description: A polyclonal antibody for detection of THYN1 from Human, Mouse, Rat. This THYN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human THYN1 protein

THYN1 antibody
70R-3715	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal THYN1 antibody raised against the middle region of THYN1

THYN1 antibody
70R-4037	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal THYN1 antibody raised against the N terminal of THYN1

THYN1 antibody
70R-20818	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal THYN1 antibody

THYN1 Antibody
40147-100ul	SAB	100ul	EUR 252

THYN1 Antibody
1-CSB-PA693156	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

THYN1 Antibody
1-CSB-PA187498	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

THYN1 Antibody
1-CSB-PA023526GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THYN1. Recognizes THYN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

THYN1 Conjugated Antibody
C40147	SAB	100ul	EUR 397

anti- THYN1 antibody
FNab08682	FN Test	100µg	EUR 548.75
Immunogen: thymocyte nuclear protein 1 Uniprot ID: Q9P016 Gene ID: 29087 Research Area: Cell Division and Proliferation, Cancer
Description: Antibody raised against THYN1

Human THYN1 Antibody
32297-05111	AssayPro	150 ug	EUR 261

Anti-THYN1 antibody
PAab08682	Lifescience Market	100 ug	EUR 386

Anti-THYN1 antibody
STJ192959	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to THYN1

Thyn1/ Rat Thyn1 ELISA Kit
ELI-52045r	Lifescience Market	96 Tests	EUR 886

THYN1 siRNA
20-abx905570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

THYN1 siRNA
20-abx936748	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

THYN1 siRNA
20-abx936749	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human)
4-PAC791Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1)

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat)
4-PAC791Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1)

THYN1 cloning plasmid
CSB-CL023526HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 501 Sequence: atgtcgagaccccggaagaggctggctgggacttctggttcagacaagggactatcaggaaaacgcaccaaaactgagaactcaggtgaggcattagctaaagtggaggactccaaccctcagaagacttcagccactaaaaactgtttgaagaatctaagcagccactggctgat Show more
Description: A cloning plasmid for the THYN1 gene.

THYN1 Blocking Peptide
33R-6487	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-4037

THYN1 Blocking Peptide
33R-6820	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of THYN1 antibody, catalog no. 70R-3715

Human THYN1 Antibody (Biotin Conjugate)
32297-05121	AssayPro	150 ug	EUR 369

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC
4-PAC791Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Biotinylated
4-PAC791Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), Cy3
4-PAC791Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), FITC
4-PAC791Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), HRP
4-PAC791Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), PE
4-PAC791Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC
4-PAC791Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Biotinylated
4-PAC791Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Biotin.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), Cy3
4-PAC791Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with Cy3.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), FITC
4-PAC791Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with FITC.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), HRP
4-PAC791Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with HRP.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), PE
4-PAC791Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with PE.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Thymocyte nuclear protein 1(THYN1) ELISA kit
E04T0692-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx116090	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx131638	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx131639	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx339588	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
abx238682-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Thymocyte Nuclear Protein 1 (THYN1) Antibody
20-abx211306	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human THYN1 AssayLite Antibody (FITC Conjugate)
32297-05141	AssayPro	150 ug	EUR 428

Human THYN1 AssayLite Antibody (RPE Conjugate)
32297-05151	AssayPro	150 ug	EUR 428

Human THYN1 AssayLite Antibody (APC Conjugate)
32297-05161	AssayPro	150 ug	EUR 428

Human THYN1 AssayLite Antibody (PerCP Conjugate)
32297-05171	AssayPro	150 ug	EUR 471

Mouse THYN1 shRNA Plasmid
20-abx978838	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat THYN1 shRNA Plasmid
20-abx989056	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

THYN1 ELISA KIT|Human
EF003598	Lifescience Market	96 Tests	EUR 689

Human THYN1 shRNA Plasmid
20-abx959180	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

THYN1 protein (His tag)
80R-1522	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human THYN1 protein

THYN1 Recombinant Protein (Human)
RP031534	ABM	100 ug	Ask for price

THYN1 Recombinant Protein (Rat)
RP233099	ABM	100 ug	Ask for price

THYN1 Recombinant Protein (Mouse)
RP178676	ABM	100 ug	Ask for price

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Human), APC-Cy7
4-PAC791Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser225) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

Thymocyte Nuclear Protein 1 (THYN1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC791Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: THYN1 (Met1~Ser226) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Thymocyte Nuclear Protein 1 (THYN1). This antibody is labeled with APC-Cy7.

Thyn1 ORF Vector (Mouse) (pORF)
ORF059560	ABM	1.0 ug DNA	EUR 506

THYN1 ORF Vector (Human) (pORF)
ORF010512	ABM	1.0 ug DNA	EUR 95

Thyn1 ORF Vector (Rat) (pORF)
ORF077701	ABM	1.0 ug DNA	EUR 506

THYN1 sgRNA CRISPR Lentivector set (Human)
K2372401	ABM	3 x 1.0 ug	EUR 339

Thyn1 sgRNA CRISPR Lentivector set (Mouse)
K4954201	ABM	3 x 1.0 ug	EUR 339

Thyn1 sgRNA CRISPR Lentivector set (Rat)
K7166101	ABM	3 x 1.0 ug	EUR 339

Recombinant Thymocyte Nuclear Protein 1 (THYN1)
4-RPC791Hu01	Cloud-Clone	EUR 386.72 EUR 206.00 EUR 1175.20 EUR 458.40 EUR 816.80 EUR 322.00 EUR 2788.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9P016 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Thymocyte Nuclear Protein 1 expressed in: E.coli

Recombinant Thymocyte Nuclear Protein 1 (THYN1)
4-RPC791Ra01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6P3E0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat Thymocyte Nuclear Protein 1 expressed in: E.coli

Human Thymocyte Nuclear Protein 1 (THYN1) Protein
20-abx650181	Abbexa	EUR 551.00 EUR 244.00 EUR 1595.00 EUR 648.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Thymocyte Nuclear Protein 1 (THYN1) Protein
20-abx650182	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

THYN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2372402	ABM	1.0 ug DNA	EUR 154

THYN1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2372403	ABM	1.0 ug DNA	EUR 154

THYN1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2372404	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4954202	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4954203	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4954204	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7166102	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7166103	ABM	1.0 ug DNA	EUR 154

Thyn1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7166104	ABM	1.0 ug DNA	EUR 154

THYN1 Protein Vector (Human) (pPB-C-His)
PV042045	ABM	500 ng	EUR 329

THYN1 Protein Vector (Human) (pPB-N-His)
PV042046	ABM	500 ng	EUR 329

THYN1 Protein Vector (Human) (pPM-C-HA)
PV042047	ABM	500 ng	EUR 329

THYN1 Protein Vector (Human) (pPM-C-His)
PV042048	ABM	500 ng	EUR 329

Recombinant Human THYN1 Protein, His, E.coli-1mg
QP13747-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human THYN1 Protein, His, E.coli-20ug
QP13747-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human THYN1 Protein, His, E.coli-5ug
QP13747-5ug	EnQuireBio	5ug	EUR 155

THYN1 Protein Vector (Rat) (pPB-C-His)
PV310802	ABM	500 ng	EUR 603

THYN1 Protein Vector (Rat) (pPB-N-His)
PV310803	ABM	500 ng	EUR 603

THYN1 Protein Vector (Rat) (pPM-C-HA)
PV310804	ABM	500 ng	EUR 603

THYN1 Protein Vector (Rat) (pPM-C-His)
PV310805	ABM	500 ng	EUR 603

THYN1 Protein Vector (Mouse) (pPB-C-His)
PV238238	ABM	500 ng	EUR 603

THYN1 Protein Vector (Mouse) (pPB-N-His)
PV238239	ABM	500 ng	EUR 603

THYN1 Protein Vector (Mouse) (pPM-C-HA)
PV238240	ABM	500 ng	EUR 603

THYN1 Protein Vector (Mouse) (pPM-C-His)
PV238241	ABM	500 ng	EUR 603

Thyn1 3'UTR GFP Stable Cell Line
TU170479	ABM	1.0 ml	Ask for price

THYN1 3'UTR GFP Stable Cell Line
TU075565	ABM	1.0 ml	EUR 1394

Thyn1 3'UTR Luciferase Stable Cell Line
TU120479	ABM	1.0 ml	Ask for price

THYN1 3'UTR Luciferase Stable Cell Line
TU025565	ABM	1.0 ml	EUR 1394

Thyn1 3'UTR Luciferase Stable Cell Line
TU221879	ABM	1.0 ml	Ask for price

Thyn1 3'UTR GFP Stable Cell Line
TU271879	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

THYN1 Rabbit Polyclonal Antibody