GLP2R Rabbit Polyclonal Antibody

GLP2R Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GLP2R Polyclonal Antibody

ES11491-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GLP2R from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GLP2R Rabbit pAb

A6602-100ul 100 ul
EUR 308

GLP2R Rabbit pAb

A6602-200ul 200 ul
EUR 459

GLP2R Rabbit pAb

A6602-20ul 20 ul
EUR 183

GLP2R Rabbit pAb

A6602-50ul 50 ul
EUR 223

Polyclonal GLP2R Antibody (Internal)

APR01964G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (Internal). This antibody is tested and proven to work in the following applications:

GLP2R antibody

39037-100ul 100ul
EUR 252

GLP2R Antibody

43319-100ul 100ul
EUR 252

GLP2R Antibody

DF10216 200ul
EUR 304
Description: GLP2R Antibody detects endogenous levels of total GLP2R.

GLP2R Antibody

1-CSB-PA286159
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

GLP2R antibody

70R-5959 50 ug
EUR 467
Description: Rabbit polyclonal GLP2R antibody raised against the N terminal of GLP2R

GLP2R Antibody

1-CSB-PA025580
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GLP2R Antibody

1-CSB-PA009515ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GLP2R. Recognizes GLP2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GLP2R Antibody

ABD10216 100 ug
EUR 438

Polyclonal GLP2R Antibody (C-Terminus)

APR01965G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GLP2R (C-Terminus). This antibody is tested and proven to work in the following applications:

Glp2r/ Rat Glp2r ELISA Kit

ELI-43481r 96 Tests
EUR 886

GLP2R Conjugated Antibody

C39037 100ul
EUR 397

Anti-GLP2R antibody

STJ28685 100 µl
EUR 277
Description: This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis.

Anti-GLP2R Antibody

STJ501181 100 µg
EUR 476

Anti-GLP2R antibody

STJ192649 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GLP2R

GLP2R siRNA

20-abx902184
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GLP2R siRNA

20-abx918019
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GLP2R siRNA

20-abx918020
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GLP2R

YF-PA25313 50 ul
EUR 334
Description: Mouse polyclonal to GLP2R

Anti-GLP2R Antibody BIOTIN

STJ501182 100 µg
EUR 586

Anti-GLP2R Antibody FITC

STJ501183 100 µg
EUR 586

GLP2R Blocking Peptide

33R-4510 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GLP2R antibody, catalog no. 70R-5959

GLP2R Blocking Peptide

DF10216-BP 1mg
EUR 195

GLP2R cloning plasmid

CSB-CL009515HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1662
  • Sequence: ATGAAGCTGGGATCGAGCAGGGCAGGGCCTGGGAGAGGAAGCGCGGGACTCCTGCCTGGCGTCCACGAGCTGCCCATGGGCATCCCTGCCCCCTGGGGGACCAGTCCTCTCTCCTTCCACAGGAAGTGCTCTCTCTGGGCCCCTGGGAGGCCCTTCCTCACTCTGGTCCTGCTGG
  • Show more
Description: A cloning plasmid for the GLP2R gene.

Anti-GLP2R (1F2)

YF-MA16783 100 ug
EUR 363
Description: Mouse monoclonal to GLP2R

GLP2R ELISA KIT|Human

EF005042 96 Tests
EUR 689

Rat GLP2R shRNA Plasmid

20-abx986050
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GLP2R shRNA Plasmid

20-abx956181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GLP2R shRNA Plasmid

20-abx979251
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GLP2R Recombinant Protein (Human)

RP039493 100 ug Ask for price

GLP2R Recombinant Protein (Rat)

RP202799 100 ug Ask for price

GLP2R Recombinant Protein (Mouse)

RP136721 100 ug Ask for price

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

20-abx005063
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

20-abx005620
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

abx215627-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

20-abx213173
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glucagon-Like Peptide 2 Receptor (GLP2R) Antibody

20-abx210518
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GLP2R Rabbit Polyclonal Antibody