OCLN Rabbit Polyclonal Antibody

OCLN Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

OCLN Polyclonal Antibody

ES11811-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OCLN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OCLN Polyclonal Antibody

ABP59636-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
  • Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

OCLN Polyclonal Antibody

ABP59636-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
  • Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

OCLN Polyclonal Antibody

ABP59636-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
  • Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

Human Occludin (OCLN) ELISA Kit

DLR-OCLN-Hu-48T 48T
EUR 517
  • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit

DLR-OCLN-Hu-96T 96T
EUR 673
  • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit

DLR-OCLN-Mu-48T 48T
EUR 527
  • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit

DLR-OCLN-Mu-96T 96T
EUR 688
  • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit

DLR-OCLN-Ra-48T 48T
EUR 549
  • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit

DLR-OCLN-Ra-96T 96T
EUR 718
  • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit

RD-OCLN-Hu-48Tests 48 Tests
EUR 521

Human Occludin (OCLN) ELISA Kit

RD-OCLN-Hu-96Tests 96 Tests
EUR 723

Mouse Occludin (OCLN) ELISA Kit

RD-OCLN-Mu-48Tests 48 Tests
EUR 533

Mouse Occludin (OCLN) ELISA Kit

RD-OCLN-Mu-96Tests 96 Tests
EUR 740

Rat Occludin (OCLN) ELISA Kit

RD-OCLN-Ra-48Tests 48 Tests
EUR 557

Rat Occludin (OCLN) ELISA Kit

RD-OCLN-Ra-96Tests 96 Tests
EUR 775

Human Occludin (OCLN) ELISA Kit

RDR-OCLN-Hu-48Tests 48 Tests
EUR 544

Human Occludin (OCLN) ELISA Kit

RDR-OCLN-Hu-96Tests 96 Tests
EUR 756

Mouse Occludin (OCLN) ELISA Kit

RDR-OCLN-Mu-48Tests 48 Tests
EUR 557

Mouse Occludin (OCLN) ELISA Kit

RDR-OCLN-Mu-96Tests 96 Tests
EUR 774

Rat Occludin (OCLN) ELISA Kit

RDR-OCLN-Ra-48Tests 48 Tests
EUR 583

Rat Occludin (OCLN) ELISA Kit

RDR-OCLN-Ra-96Tests 96 Tests
EUR 811

Rabbit OCLN ELISA Kit

ERTO0016 96Tests
EUR 521

Polyclonal OCLN Antibody (C-term)

APR17653G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OCLN (C-term). This antibody is tested and proven to work in the following applications:

Occludin (OCLN) Polyclonal Antibody (Mouse)

4-PAC228Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN)

OCLN Antibody

35850-100ul 100ul
EUR 252

OCLN Antibody

24902-100ul 100ul
EUR 390

OCLN antibody

70R-19023 50 ul
EUR 435
Description: Rabbit polyclonal OCLN antibody

OCLN Antibody

1-CSB-PA385632
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

OCLN Antibody

1-CSB-PA190654
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

OCLN Antibody

1-CSB-PA016263GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

OCLN Antibody

1-CSB-PA016263LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

OCLN

RA34003 100 ul
EUR 644

Occludin (OCLN) Polyclonal Antibody (Mouse), APC

4-PAC228Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC.

Occludin (OCLN) Polyclonal Antibody (Mouse), Biotinylated

4-PAC228Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Biotin.

Occludin (OCLN) Polyclonal Antibody (Mouse), Cy3

4-PAC228Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Cy3.

Occludin (OCLN) Polyclonal Antibody (Mouse), FITC

4-PAC228Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with FITC.

Occludin (OCLN) Polyclonal Antibody (Mouse), HRP

4-PAC228Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with HRP.

Occludin (OCLN) Polyclonal Antibody (Mouse), PE

4-PAC228Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with PE.

Rabbit Occludin (OCLN) ELISA Kit

abx362127-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

OCLN Conjugated Antibody

C35850 100ul
EUR 397

Occludin (Ocln) Antibody

20-abx114256
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx135728
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx100283
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Occludin (OCLN) Antibody

20-abx005226
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

abx027678-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

abx027678-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx173883
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Occludin (OCLN) Antibody

20-abx173884
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Occludin (OCLN) Antibody

20-abx177849
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Occludin (OCLN) Antibody

20-abx177850
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Occludin (OCLN) Antibody

20-abx177851
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Occludin (OCLN) Antibody

20-abx213716
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx213972
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx217323
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

20-abx338520
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody

abx235957-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-OCLN antibody

STJ111161 100 µl
EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody

STJ114495 100 µl
EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody

STJ192969 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OCLN

Ocln/ Rat Ocln ELISA Kit

ELI-14841r 96 Tests
EUR 886

Occludin (OCLN) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC228Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OCLN (Phe17~Ser107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC-Cy7.

OCLN siRNA

20-abx903729
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OCLN siRNA

20-abx926764
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OCLN siRNA

20-abx926765
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human(OCLN)

QY-E05310 96T
EUR 361

Rabbit Anti-OCLN monoclonal antibody, clone KK102-19

DCABH-5086 100 ul
EUR 777

Occludin (OCLN) Antibody (HRP)

20-abx336871
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody (FITC)

20-abx336872
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody (Biotin)

20-abx336873
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Occludin (OCLN) Antibody (Biotin)

20-abx272823
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

OCLN Antibody, HRP conjugated

1-CSB-PA016263LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OCLN Antibody, FITC conjugated

1-CSB-PA016263LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OCLN Antibody, Biotin conjugated

1-CSB-PA016263LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Occludin/OCLN Antibody

RP1057 100ug/vial
EUR 334

OCLN cloning plasmid

CSB-CL016263HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgtcatccaggcctcttgaaagtccacctccttacaggcctgatgaattcaaaccgaatcattatgcaccaagcaatgacatatatggtggagagatgcatgttcgaccaatgctctctcagccagcctactctttttacccagaagatgaaattcttcacttctacaaatgga
  • Show more
Description: A cloning plasmid for the OCLN gene.

Recombinant Occludin (OCLN)

4-RPC228Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q61146
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Occludin expressed in: E.coli

Anti-OCLN (5A7)

YF-MA20378 100 ug
EUR 363
Description: Mouse monoclonal to OCLN

Human Occludin (OCLN) Protein

20-abx654597
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Occludin (OCLN) Protein

20-abx654599
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat OCLN shRNA Plasmid

20-abx986766
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OCLN ELISA Kit

EHO0016 96Tests
EUR 521

Human OCLN ELISA Kit

ELA-E14928h 96 Tests
EUR 824

Goat OCLN ELISA Kit

EGTO0016 96Tests
EUR 521

Bovine OCLN ELISA Kit

EBO0016 96Tests
EUR 521

CHICKEN OCLN ELISA KIT

ECKO0016 96Tests
EUR 521

Canine OCLN ELISA Kit

ECO0016 96Tests
EUR 521

Anserini OCLN ELISA Kit

EAO0016 96Tests
EUR 521

Canine OCLN ELISA KIT

ELI-13288d 96 Tests
EUR 928

OCLN ELISA KIT|Human

EF005821 96 Tests
EUR 689

Porcine OCLN ELISA Kit

EPO0016 96Tests
EUR 521

Rat OCLN ELISA Kit

ERO0016 96Tests
EUR 521

Sheep OCLN ELISA Kit

ESO0016 96Tests
EUR 521

Monkey OCLN ELISA Kit

EMKO0016 96Tests
EUR 521

Mouse OCLN ELISA Kit

EMO0016 96Tests
EUR 521

Mouse Occludin (OCLN) Protein

20-abx068376
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human OCLN shRNA Plasmid

20-abx968922
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OCLN shRNA Plasmid

20-abx971853
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OCLN Recombinant Protein (Human)

RP022045 100 ug Ask for price

OCLN Recombinant Protein (Rat)

RP215030 100 ug Ask for price

pCMV-SPORT6-OCLN Plasmid

PVTB00550 2 ug
EUR 356

pLenti6/v5-OCLN Plasmid

PVTB00550-2b 2 ug
EUR 356

OCLN Recombinant Protein (Mouse)

RP155726 100 ug Ask for price

Monoclonal OCLN Antibody (monoclonal) (M01), Clone: 1G7

APR17654G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human OCLN (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1G7. This antibody is applicable in WB and IF, IP, E

Chicken Occludin (OCLN) ELISA Kit

abx517212-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Dog Occludin (OCLN) ELISA Kit

abx517213-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Occludin (OCLN) ELISA Kit

abx361109-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Occludin (OCLN) ELISA Kit

abx570647-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Occludin (OCLN) ELISA Kit

abx572435-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Guinea Pig OCLN ELISA Kit

EGO0016 96Tests
EUR 521

Mouse Ocln/ Occludin ELISA Kit

E1073Mo 1 Kit
EUR 632

Human OCLN/ Occludin ELISA Kit

E1819Hu 1 Kit
EUR 605

Human OCLN(Occludin) ELISA Kit

EH1674 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q16625
  • Alias: OCLN(Occludin)/BLCPMG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Occludin, OCLN ELISA KIT

ELI-21396h 96 Tests
EUR 824

Chicken Occludin, OCLN ELISA KIT

ELI-22451c 96 Tests
EUR 928

Rat OCLN(Occludin) ELISA Kit

ER1206 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q6P6T5
  • Alias: OCLN/BLCPMG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Occludin, Ocln ELISA KIT

ELI-44575m 96 Tests
EUR 865

Monkey OCLN(Occludin) ELISA Kit

EMK0112 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Alias: Occludin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Ape;Sensitivity: 0.094 ng/ml

Rat Occludin (OCLN) ELISA Kit

20-abx155925
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Occludin (OCLN) ELISA Kit

20-abx154483
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Occludin (OCLN) ELISA Kit

20-abx152580
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Occludin (OCLN) CLIA Kit

abx195254-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Occludin (OCLN) ELISA Kit

abx357187-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Occludin (OCLN) CLIA Kit

20-abx493554
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Occludin (OCLN) CLIA Kit

20-abx493555
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Occludin (OCLN) CLIA Kit

20-abx493556
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Occludin (OCLN) ELISA Kit

abx255868-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Monkey Occludin (OCLN) ELISA Kit

abx257872-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

OCLN Rabbit Polyclonal Antibody