RBM10 Rabbit Polyclonal Antibody

RBM10 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBM10 Polyclonal Antibody

ES11966-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RBM10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBM10 Polyclonal Antibody

ES11966-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RBM10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBM10 Rabbit pAb

A4209-100ul 100 ul
EUR 308

RBM10 Rabbit pAb

A4209-200ul 200 ul
EUR 459

RBM10 Rabbit pAb

A4209-20ul 20 ul
EUR 183

RBM10 Rabbit pAb

A4209-50ul 50 ul
EUR 223

RBM10 antibody

70R-19802 50 ul
EUR 435
Description: Rabbit polyclonal RBM10 antibody

RBM10 Antibody

47325-100ul 100ul
EUR 252

RBM10 Antibody

1-CSB-PA019400GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RBM10 Antibody

1-CSB-PA019400LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200, IF:1:50-1:200

RBM10 Polyclonal Antibody, HRP Conjugated

A63295 100 µg
EUR 570.55
Description: reagents widely cited

RBM10 Polyclonal Antibody, FITC Conjugated

A63296 100 µg
EUR 570.55
Description: Ask the seller for details

RBM10 Polyclonal Antibody, Biotin Conjugated

A63297 100 µg
EUR 570.55
Description: The best epigenetics products

Rbm10/ Rat Rbm10 ELISA Kit

ELI-36004r 96 Tests
EUR 886

RBM10 Conjugated Antibody

C47325 100ul
EUR 397

anti- RBM10 antibody

FNab07158 100µg
EUR 548.75
  • Immunogen: RNA binding motif protein 10
  • Uniprot ID: P98175
  • Gene ID: 8241
  • Research Area: Metabolism
Description: Antibody raised against RBM10

Anti-RBM10 antibody

PAab07158 100 ug
EUR 386

Anti-RBM10 antibody

STJ25312 100 µl
EUR 277
Description: This gene encodes a nuclear protein that belongs to a family proteins that contain an RNA-binding motif. The encoded protein associates with hnRNP proteins and may be involved in regulating alternative splicing. Defects in this gene are the cause of the X-linked recessive disorder, TARP syndrome. Alternate splicing results in multiple transcript variants.

Anti-RBM10 antibody

STJ193124 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBM10

RBM10 siRNA

20-abx904494
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM10 siRNA

20-abx931024
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM10 siRNA

20-abx931025
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBM10 Antibody, HRP conjugated

1-CSB-PA019400LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBM10 Antibody, FITC conjugated

1-CSB-PA019400LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBM10 Antibody, Biotin conjugated

1-CSB-PA019400LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBM10 cloning plasmid

CSB-CL019400HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2793
  • Sequence: atggagtatgaaagacgtggtggtcgtggtgacaggactggccgctatggagccactgaccgctcgcaggatgatggtggggagaaccgcagccgagaccacgactaccgggacatggactaccgttcatatcctcgcgagtatggcagccaggagggcaagcatgactatgacg
  • Show more
Description: A cloning plasmid for the RBM10 gene.

RBM10 cloning plasmid

CSB-CL019400HU2-10ug 10ug
EUR 826
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2559
  • Sequence: atggagtatgaaagacgtggtggtcgtggtgacaggactggccgctatggagccactgaccgctcgcaggatgatggtggggagaaccgcagccgagaccacgactaccgggacatggactaccgttcatatcctcgcgagtatggcagccaggagggcaagcatgactatgacg
  • Show more
Description: A cloning plasmid for the RBM10 gene.

Anti-RBM10 (2F12)

YF-MA16316 100 ug
EUR 363
Description: Mouse monoclonal to RBM10

RBM10 ELISA KIT|Human

EF002345 96 Tests
EUR 689

Rat RBM10 shRNA Plasmid

20-abx986260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RBM10 shRNA Plasmid

20-abx955411
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RBM10 shRNA Plasmid

20-abx982250
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

h RBM10 inducible lentivirus

LVP1124 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: RBM10 (RNA binding motif protein 10), [alternative names: DXS8237E; GPATC9; GPATCH9; S1-1; TARPS; ZRANB5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005676.4 . It also contains a RFP-Blasticidin dual selection marker.

RNA Binding Motif Protein 10 (RBM10) Antibody

20-abx003115
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rna Binding Motif Protein 10 (RBM10) Antibody

20-abx115309
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 10 (RBM10) Antibody

abx028559-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 10 (RBM10) Antibody

abx028559-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA Binding Motif Protein 10 (RBM10) Antibody

abx237158-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RNA Binding Motif Protein 10 (RBM10) Antibody

20-abx317941
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rbm10 ORF Vector (Rat) (pORF)

ORF074599 1.0 ug DNA
EUR 506

h RBM10 (GFP-Puro) Lentivirus

LVP1124-GP 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: RBM10 (RNA binding motif protein 10), [alternative names: DXS8237E; GPATC9; GPATCH9; S1-1; TARPS; ZRANB5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005676.4 . It also contains a GFP-Puromycin dual selection marker.

RBM10 ORF Vector (Human) (pORF)

ORF008630 1.0 ug DNA
EUR 95

RBM10 ORF Vector (Human) (pORF)

ORF008631 1.0 ug DNA
EUR 95

Rbm10 ORF Vector (Mouse) (pORF)

ORF055699 1.0 ug DNA
EUR 506

Rbm10 ORF Vector (Mouse) (pORF)

ORF055700 1.0 ug DNA
EUR 506

Rbm10 ORF Vector (Mouse) (pORF)

ORF055701 1.0 ug DNA
EUR 506

Cytokeratin 10 MonoSpecific Antibody, Unconjugated-20ug

3858-RBM10-P0 20ug
EUR 233

Cytokeratin 10 MonoSpecific Antibody, Unconjugated-100ug

3858-RBM10-P1 100ug
EUR 428

RNA Binding Motif Protein 10 (RBM10) Antibody (HRP)

20-abx305067
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RBM10 Rabbit Polyclonal Antibody