GPER Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
GPER Polyclonal Antibody |
ABP58682-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
- Applications tips:
|
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380 |
GPER Polyclonal Antibody |
ABP58682-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
- Applications tips:
|
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380 |
GPER Polyclonal Antibody |
ES11471-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GPER Polyclonal Antibody |
ES11471-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Polyclonal GPER Antibody (C-term) |
APR07130G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications: |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
DLR-GPER-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
DLR-GPER-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
DLR-GPER-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
DLR-GPER-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RDR-GPER-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RDR-GPER-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RDR-GPER-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RDR-GPER-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RD-GPER-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RD-GPER-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RD-GPER-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit |
RD-GPER-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Polyclonal GPER antibody - C-terminal region |
AMRa00042G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-GPER antibody |
STJ192629 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GPER |
GPER cloning plasmid |
CSB-CL859933HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1128
- Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc
- Show more
|
Description: A cloning plasmid for the GPER gene. |
GPER Rabbit Polyclonal Antibody