GPER Rabbit Polyclonal Antibody

GPER Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GPER Polyclonal Antibody
ABP58682-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380 Applications tips:
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380

GPER Polyclonal Antibody
ABP58682-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380 Applications tips:
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380

GPER Polyclonal Antibody
ES11471-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPER Polyclonal Antibody
ES11471-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal GPER Antibody (C-term)
APR07130G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Hu-48T	DL Develop	48T	EUR 517
Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Hu-96T	DL Develop	96T	EUR 673
Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Gper/ Rat Gper ELISA Kit
ELI-03937r	Lifescience Market	96 Tests	EUR 886

Polyclonal GPER antibody - C-terminal region
AMRa00042G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-GPER antibody
STJ192629	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPER

GPER cloning plasmid
CSB-CL859933HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1128 Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc Show more
Description: A cloning plasmid for the GPER gene.

GPER ELISA KIT|Human
EF004242	Lifescience Market	96 Tests	EUR 689

GPER Rabbit Polyclonal Antibody