GPER Rabbit Polyclonal Antibody

GPER Rabbit Polyclonal Antibody

To Order Now:

GPER Polyclonal Antibody
ABP58682-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
GPER Polyclonal Antibody
ABP58682-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
  • Applications tips:
Description: A polyclonal antibody for detection of GPER from Human, Mouse, Rat. This GPER antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPER protein at amino acid sequence of 300-380
GPER Polyclonal Antibody
ES11471-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GPER Polyclonal Antibody
ES11471-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPER from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Polyclonal GPER Antibody (C-term)
APR07130G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
EUR 517
  • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
EUR 673
  • Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
EUR 527
  • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
EUR 688
  • Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-48Tests 48 Tests
EUR 544
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-96Tests 96 Tests
EUR 756
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-48Tests 48 Tests
EUR 557
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-96Tests 96 Tests
EUR 774
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-48Tests 48 Tests
EUR 521
Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-96Tests 96 Tests
EUR 723
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-48Tests 48 Tests
EUR 533
Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-96Tests 96 Tests
EUR 740
Gper/ Rat Gper ELISA Kit
ELI-03937r 96 Tests
EUR 886
Polyclonal GPER antibody - C-terminal region
AMRa00042G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:
Anti-GPER antibody
STJ192629 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPER
GPER cloning plasmid
CSB-CL859933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc
  • Show more
Description: A cloning plasmid for the GPER gene.
EF004242 96 Tests
EUR 689

GPER Rabbit Polyclonal Antibody