RXFP1 Rabbit Polyclonal Antibody

RXFP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RXFP1 Polyclonal Antibody
ABP60284-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
RXFP1 Polyclonal Antibody
ABP60284-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
RXFP1 Polyclonal Antibody
ES11633-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RXFP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RXFP1 Polyclonal Antibody
ES11633-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RXFP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RXFP1 Rabbit pAb
A7127-100ul 100 ul
EUR 308
RXFP1 Rabbit pAb
A7127-200ul 200 ul
EUR 459
RXFP1 Rabbit pAb
A7127-20ul 20 ul
EUR 183
RXFP1 Rabbit pAb
A7127-50ul 50 ul
EUR 223
RXFP1 Antibody
44621-100ul 100ul
EUR 252
RXFP1 Antibody
44621-50ul 50ul
EUR 187
RXFP1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
RXFP1 Antibody
DF10265 200ul
EUR 304
Description: RXFP1 Antibody detects endogenous levels of total RXFP1.
RXFP1 Antibody
ABD10265 100 ug
EUR 438
Rabbit RXFP1 ELISA Kit
ERTR0126 96Tests
EUR 521
Polyclonal RXFP1/ LGR7 Antibody (C-Terminus)
AMM07700G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP1/ LGR7 (C-Terminus). This antibody is tested and proven to work in the following applications:
RXFP1 Conjugated Antibody
C44621 100ul
EUR 397
Anti-RXFP1 antibody
STJ117834 100 µl
EUR 277
Description: This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
Anti-RXFP1 antibody
STJ192791 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RXFP1
Rxfp1/ Rat Rxfp1 ELISA Kit
ELI-18418r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RXFP1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RXFP1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RXFP1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
RXFP1 Blocking Peptide
DF10265-BP 1mg
EUR 195
RXFP1 cloning plasmid
CSB-CL875715HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2274
  • Sequence: atgacatctggttctgtcttcttctacatcttaatttttggaaaatatttttctcatgggggtggacaggatgtcaagtgctcccttggctatttcccctgtgggaacatcacaaagtgcttgcctcagctcctgcactgtaacggtgtggacgactgcgggaatcaggccgatg
  • Show more
Description: A cloning plasmid for the RXFP1 gene.
EHR0126 96Tests
EUR 521
Bovine RXFP1 ELISA Kit
EBR0126 96Tests
EUR 521
Anserini RXFP1 ELISA Kit
EAR0126 96Tests
EUR 521
Canine RXFP1 ELISA Kit
ECR0126 96Tests
EUR 521
EGTR0126 96Tests
EUR 521
EF007150 96 Tests
EUR 689
Rat RXFP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse RXFP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RXFP1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Porcine RXFP1 ELISA Kit
EPR0126 96Tests
EUR 521
ERR0126 96Tests
EUR 521
EMR0126 96Tests
EUR 521
RXFP1 Recombinant Protein (Human)
RP043066 100 ug Ask for price
RXFP1 Recombinant Protein (Rat)
RP227312 100 ug Ask for price
RXFP1 Recombinant Protein (Mouse)
RP169733 100 ug Ask for price
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)
Guinea Pig RXFP1 ELISA Kit
EGR0126 96Tests
EUR 521
Rxfp1 ORF Vector (Rat) (pORF)
ORF075772 1.0 ug DNA
EUR 506
RXFP1 ORF Vector (Human) (pORF)
ORF014356 1.0 ug DNA
EUR 354
Rxfp1 ORF Vector (Mouse) (pORF)
ORF056579 1.0 ug DNA
EUR 506
RXFP1 ELISA Kit (Human) (OKEI00271)
OKEI00271 96 Wells
EUR 767
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL
RXFP1 ELISA Kit (Mouse) (OKEI00537)
OKEI00537 96 Wells
EUR 767
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL
RXFP1 ELISA Kit (Rat) (OKWB00369)
OKWB00369 96 Wells
EUR 572
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.
Rabbit Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) ELISA Kit
abx362225-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rxfp1 sgRNA CRISPR Lentivector set (Rat)
K7377201 3 x 1.0 ug
EUR 339
Rxfp1 sgRNA CRISPR Lentivector set (Mouse)
K3351801 3 x 1.0 ug
EUR 339
RXFP1 sgRNA CRISPR Lentivector set (Human)
K2080101 3 x 1.0 ug
EUR 339
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro260~Met409)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
abx122948-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Mouse Relaxin receptor 1, Rxfp1 ELISA KIT
ELI-29419m 96 Tests
EUR 865
Human Relaxin receptor 1, RXFP1 ELISA KIT
ELI-41553h 96 Tests
EUR 824
Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7377202 1.0 ug DNA
EUR 154
Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7377203 1.0 ug DNA
EUR 154
Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7377204 1.0 ug DNA
EUR 154
Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3351802 1.0 ug DNA
EUR 154
Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3351803 1.0 ug DNA
EUR 154
Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3351804 1.0 ug DNA
EUR 154
RXFP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2080102 1.0 ug DNA
EUR 154
RXFP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2080103 1.0 ug DNA
EUR 154
RXFP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2080104 1.0 ug DNA
EUR 154
RXFP1 Protein Vector (Rat) (pPB-C-His)
PV303086 500 ng
EUR 1166
RXFP1 Protein Vector (Rat) (pPB-N-His)
PV303087 500 ng
EUR 1166
RXFP1 Protein Vector (Rat) (pPM-C-HA)
PV303088 500 ng
EUR 1166
RXFP1 Protein Vector (Rat) (pPM-C-His)
PV303089 500 ng
EUR 1166
RXFP1 Protein Vector (Human) (pPB-C-His)
PV057421 500 ng
EUR 481
RXFP1 Protein Vector (Human) (pPB-N-His)
PV057422 500 ng
EUR 481
RXFP1 Protein Vector (Human) (pPM-C-HA)
PV057423 500 ng
EUR 481
RXFP1 Protein Vector (Human) (pPM-C-His)
PV057424 500 ng
EUR 481
RXFP1 Protein Vector (Mouse) (pPB-C-His)
PV226314 500 ng
EUR 1065
RXFP1 Protein Vector (Mouse) (pPB-N-His)
PV226315 500 ng
EUR 1065
RXFP1 Protein Vector (Mouse) (pPM-C-HA)
PV226316 500 ng
EUR 1065
RXFP1 Protein Vector (Mouse) (pPM-C-His)
PV226317 500 ng
EUR 1065
Rxfp1 3'UTR Luciferase Stable Cell Line
TU118273 1.0 ml Ask for price
Rxfp1 3'UTR GFP Stable Cell Line
TU168273 1.0 ml Ask for price
Rxfp1 3'UTR Luciferase Stable Cell Line
TU219857 1.0 ml Ask for price

RXFP1 Rabbit Polyclonal Antibody