RBMS3 Rabbit Polyclonal Antibody

RBMS3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBMS3 Polyclonal Antibody

ABP60117-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody

ABP60117-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody

ES11856-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBMS3 Polyclonal Antibody

ES11856-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBMS3 Rabbit pAb

A17142-100ul 100 ul
EUR 308

RBMS3 Rabbit pAb

A17142-200ul 200 ul
EUR 459

RBMS3 Rabbit pAb

A17142-20ul 20 ul
EUR 183

RBMS3 Rabbit pAb

A17142-50ul 50 ul
EUR 223

RBMS3 antibody

70R-1317 100 ug
EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the N terminal of RBMS3

RBMS3 antibody

70R-1318 100 ug
EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the C terminal of RBMS3

RBMS3 Antibody

37025-100ul 100ul
EUR 252

RBMS3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:100

RBMS3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

RBMS3 Antibody

DF8599 200ul
EUR 304
Description: RBMS3 Antibody detects endogenous levels of total RBMS3.

RBMS3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RBMS3 antibody

70R-4798 50 ug
EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 antibody

70R-4803 50 ug
EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 Antibody

ABD8599 100 ug
EUR 438

RBMS3 Polyclonal Antibody, HRP Conjugated

A68984 100 ?g
EUR 628.55
Description: The best epigenetics products

RBMS3 Polyclonal Antibody, FITC Conjugated

A68985 100 ?g
EUR 628.55
Description: kits suitable for this type of research

RBMS3 Polyclonal Antibody, Biotin Conjugated

A68986 100 ?g
EUR 628.55
Description: fast delivery possible

Anti-RBMS3 Antibody

A12416 100ul
EUR 397
Description: Rabbit Polyclonal RBMS3 Antibody. Validated in WB and tested in Human, Mouse.

Anti-RBMS3 Antibody

A12416-3 100ug/vial
EUR 334

Anti-RBMS3 antibody

STJ119365 100 µl
EUR 277

Anti-RBMS3 antibody

STJ193014 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBMS3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBMS3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBMS3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBMS3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBMS3 Blocking Peptide

33R-3651 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1317

RBMS3 Blocking Peptide

33R-8991 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1318

RBMS3 Blocking Peptide

33R-9391 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4798

RBMS3 Blocking Peptide

33R-7382 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4803

RBMS3 Blocking Peptide

DF8599-BP 1mg
EUR 195

RBMS3 cloning plasmid

CSB-CL761548HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgggcaaacgcctggatcagccacaaatgtacccccagtacacttactactatcctcattatctccaaaccaagcagtcctatgcaccagctccccaccccatggctcctcccagccccagcacaaacagcagcagcaacaacagcagcaacaacagcagcggggaacagttga
  • Show more
Description: A cloning plasmid for the RBMS3 gene.

Anti-RBMS3 (3B11)

YF-MA18198 100 ug
EUR 363
Description: Mouse monoclonal to RBMS3

Mouse Rbms3 ELISA KIT

ELI-52240m 96 Tests
EUR 865

Human RBMS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RBMS3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-39189h 96 Tests
EUR 824

RBMS3 Recombinant Protein (Human)

RP042793 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167261 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167264 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167267 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167270 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167273 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167276 100 ug Ask for price

RBMS3 ORF Vector (Human) (pORF)

ORF014265 1.0 ug DNA
EUR 354

Rbms3 ORF Vector (Mouse) (pORF)

ORF055755 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055756 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055757 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055758 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055759 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055760 1.0 ug DNA
EUR 506

RBMS3 sgRNA CRISPR Lentivector set (Human)

K1796701 3 x 1.0 ug
EUR 339

Rbms3 sgRNA CRISPR Lentivector set (Mouse)

K4029901 3 x 1.0 ug
EUR 339

RBMS3-AS1 ORF Vector (Human) (pORF)

ORF028771 1.0 ug DNA Ask for price

RBMS3-AS2 ORF Vector (Human) (pORF)

ORF028772 1.0 ug DNA Ask for price

RBMS3-AS3 ORF Vector (Human) (pORF)

ORF028773 1.0 ug DNA Ask for price

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1796702 1.0 ug DNA
EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1796703 1.0 ug DNA
EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1796704 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4029902 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4029903 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4029904 1.0 ug DNA
EUR 154

RBMS3 Protein Vector (Human) (pPB-C-His)

PV057057 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPB-N-His)

PV057058 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPM-C-HA)

PV057059 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPM-C-His)

PV057060 500 ng
EUR 481

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223018 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223019 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223020 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223021 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223022 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223023 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223024 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223025 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223026 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223027 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223028 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223029 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223030 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223031 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223032 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223033 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223034 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223035 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223036 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223037 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223038 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223039 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223040 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223041 500 ng
EUR 603

Rbms3 3'UTR Luciferase Stable Cell Line

TU117641 1.0 ml Ask for price

Rbms3 3'UTR GFP Stable Cell Line

TU167641 1.0 ml Ask for price

RBMS3 3'UTR GFP Stable Cell Line

TU069623 1.0 ml
EUR 1394

RBMS3 3'UTR Luciferase Stable Cell Line

TU019623 1.0 ml
EUR 1394

RBMS3 Rabbit Polyclonal Antibody