RBMS3 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 RBMS3 Polyclonal Antibody |
|
ABP60117-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein |
RBMS3 Polyclonal Antibody |
|
ABP60117-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein |
RBMS3 Polyclonal Antibody |
|
ABP60117-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein |
RBMS3 Polyclonal Antibody |
|
A68983 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: Ask the seller for details |
 RBMS3 Rabbit pAb |
|
A17142-100ul |
Abclonal |
100 ul |
EUR 308 |
RBMS3 Rabbit pAb |
|
A17142-200ul |
Abclonal |
200 ul |
EUR 459 |
RBMS3 Rabbit pAb |
|
A17142-20ul |
Abclonal |
20 ul |
EUR 183 |
RBMS3 Rabbit pAb |
|
A17142-50ul |
Abclonal |
50 ul |
EUR 223 |
 RBMS3 antibody |
|
70R-4798 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3 |
RBMS3 antibody |
|
70R-4803 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3 |
 RBMS3 Antibody |
|
37025-100ul |
SAB |
100ul |
EUR 252 |
RBMS3 antibody |
|
70R-1317 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RBMS3 antibody raised against the N terminal of RBMS3 |
RBMS3 antibody |
|
70R-1318 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RBMS3 antibody raised against the C terminal of RBMS3 |
RBMS3 Antibody |
|
DF8599 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RBMS3 Antibody detects endogenous levels of total RBMS3. |
RBMS3 Antibody |
|
1-CSB-PA998451 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:100 |
RBMS3 Antibody |
|
1-CSB-PA761548LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500 |
RBMS3 Antibody |
|
1-CSB-PA579163 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
 RBMS3 Polyclonal Antibody, HRP Conjugated |
|
A68984 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: The best epigenetics products |
 RBMS3 Polyclonal Antibody, FITC Conjugated |
|
A68985 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: kits suitable for this type of research |
 RBMS3 Polyclonal Antibody, Biotin Conjugated |
|
A68986 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
 Anti-RBMS3 Antibody |
|
A12416 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal RBMS3 Antibody. Validated in WB and tested in Human, Mouse. |
Anti-RBMS3 Antibody |
|
A12416-3 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-RBMS3 antibody |
|
STJ193014 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RBMS3 |
 RBMS3 siRNA |
|
20-abx931100 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RBMS3 siRNA |
|
20-abx931101 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RBMS3 Antibody, HRP conjugated |
|
1-CSB-PA761548LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RBMS3 Antibody, FITC conjugated |
|
1-CSB-PA761548LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RBMS3 Antibody, Biotin conjugated |
|
1-CSB-PA761548LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RBMS3 Blocking Peptide |
|
33R-3651 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1317 |
RBMS3 Blocking Peptide |
|
33R-7382 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4803 |
RBMS3 Blocking Peptide |
|
33R-8991 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1318 |
RBMS3 Blocking Peptide |
|
33R-9391 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4798 |
RBMS3 Blocking Peptide |
|
DF8599-BP |
Affbiotech |
1mg |
EUR 195 |
 RBMS3 cloning plasmid |
|
CSB-CL761548HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1302
- Sequence: atgggcaaacgcctggatcagccacaaatgtacccccagtacacttactactatcctcattatctccaaaccaagcagtcctatgcaccagctccccaccccatggctcctcccagccccagcacaaacagcagcagcaacaacagcagcaacaacagcagcggggaacagttga
- Show more
|
|
Description: A cloning plasmid for the RBMS3 gene. |
) Anti-RBMS3 (3B11) |
|
YF-MA18198 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RBMS3 |
 Mouse RBMS3 shRNA Plasmid |
|
20-abx980489 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RBMS3 shRNA Plasmid |
|
20-abx959069 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RBMS3 Recombinant Protein (Human) |
|
RP042793 |
ABM |
100 ug |
Ask for price |
) RBMS3 Recombinant Protein (Mouse) |
|
RP167261 |
ABM |
100 ug |
Ask for price |
RBMS3 Recombinant Protein (Mouse) |
|
RP167264 |
ABM |
100 ug |
Ask for price |
RBMS3 Recombinant Protein (Mouse) |
|
RP167267 |
ABM |
100 ug |
Ask for price |
RBMS3 Recombinant Protein (Mouse) |
|
RP167270 |
ABM |
100 ug |
Ask for price |
RBMS3 Recombinant Protein (Mouse) |
|
RP167273 |
ABM |
100 ug |
Ask for price |
RBMS3 Recombinant Protein (Mouse) |
|
RP167276 |
ABM |
100 ug |
Ask for price |
 (pORF)) RBMS3 ORF Vector (Human) (pORF) |
|
ORF014265 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055755 |
ABM |
1.0 ug DNA |
EUR 506 |
Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055756 |
ABM |
1.0 ug DNA |
EUR 506 |
Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055757 |
ABM |
1.0 ug DNA |
EUR 506 |
Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055758 |
ABM |
1.0 ug DNA |
EUR 506 |
Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055759 |
ABM |
1.0 ug DNA |
EUR 506 |
Rbms3 ORF Vector (Mouse) (pORF) |
|
ORF055760 |
ABM |
1.0 ug DNA |
EUR 506 |
) RBMS3 sgRNA CRISPR Lentivector set (Human) |
|
K1796701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rbms3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4029901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) RBMS3-AS1 ORF Vector (Human) (pORF) |
|
ORF028771 |
ABM |
1.0 ug DNA |
Ask for price |
 (pORF)) RBMS3-AS2 ORF Vector (Human) (pORF) |
|
ORF028772 |
ABM |
1.0 ug DNA |
Ask for price |
 (pORF)) RBMS3-AS3 ORF Vector (Human) (pORF) |
|
ORF028773 |
ABM |
1.0 ug DNA |
Ask for price |
 (Target 1)) RBMS3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1796702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RBMS3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1796703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RBMS3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1796704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4029902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4029903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4029904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RBMS3 Protein Vector (Human) (pPB-C-His) |
|
PV057057 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) RBMS3 Protein Vector (Human) (pPB-N-His) |
|
PV057058 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) RBMS3 Protein Vector (Human) (pPM-C-HA) |
|
PV057059 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) RBMS3 Protein Vector (Human) (pPM-C-His) |
|
PV057060 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223018 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223019 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223020 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223021 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223022 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223023 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223024 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223025 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223026 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223027 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223028 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223029 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223030 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223031 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223032 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223033 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223034 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223035 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223036 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223037 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-C-His) |
|
PV223038 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPB-N-His) |
|
PV223039 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223040 |
ABM |
500 ng |
EUR 603 |
RBMS3 Protein Vector (Mouse) (pPM-C-His) |
|
PV223041 |
ABM |
500 ng |
EUR 603 |
 Rbms3 3'UTR GFP Stable Cell Line |
|
TU167641 |
ABM |
1.0 ml |
Ask for price |
 RBMS3 3'UTR Luciferase Stable Cell Line |
|
TU019623 |
ABM |
1.0 ml |
EUR 1394 |
 Rbms3 3'UTR Luciferase Stable Cell Line |
|
TU117641 |
ABM |
1.0 ml |
Ask for price |
 RBMS3 3'UTR GFP Stable Cell Line |
|
TU069623 |
ABM |
1.0 ml |
EUR 1394 |
 Antibody) RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody |
|
20-abx123014 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody |
|
20-abx333747 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody |
|
20-abx212353 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody |
|
20-abx212498 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
RBMS3 Rabbit Polyclonal Antibody
