RBMS3 Rabbit Polyclonal Antibody

RBMS3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBMS3 Polyclonal Antibody

ABP60117-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody

ABP60117-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody

ABP60117-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody

A68983 100 ?g
EUR 628.55
Description: Ask the seller for details

RBMS3 Rabbit pAb

A17142-100ul 100 ul
EUR 308

RBMS3 Rabbit pAb

A17142-200ul 200 ul
EUR 459

RBMS3 Rabbit pAb

A17142-20ul 20 ul
EUR 183

RBMS3 Rabbit pAb

A17142-50ul 50 ul
EUR 223

RBMS3 antibody

70R-4798 50 ug
EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 antibody

70R-4803 50 ug
EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 Antibody

ABD8599 100 ug
EUR 438

RBMS3 Antibody

37025-100ul 100ul
EUR 252

RBMS3 antibody

70R-1317 100 ug
EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the N terminal of RBMS3

RBMS3 antibody

70R-1318 100 ug
EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the C terminal of RBMS3

RBMS3 Antibody

DF8599 200ul
EUR 304
Description: RBMS3 Antibody detects endogenous levels of total RBMS3.

RBMS3 Antibody

1-CSB-PA998451
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:100

RBMS3 Antibody

1-CSB-PA761548LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

RBMS3 Antibody

1-CSB-PA579163
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RBMS3 Polyclonal Antibody, HRP Conjugated

A68984 100 ?g
EUR 628.55
Description: The best epigenetics products

RBMS3 Polyclonal Antibody, FITC Conjugated

A68985 100 ?g
EUR 628.55
Description: kits suitable for this type of research

RBMS3 Polyclonal Antibody, Biotin Conjugated

A68986 100 ?g
EUR 628.55
Description: fast delivery possible

Anti-RBMS3 Antibody

A12416 100ul
EUR 397
Description: Rabbit Polyclonal RBMS3 Antibody. Validated in WB and tested in Human, Mouse.

Anti-RBMS3 Antibody

A12416-3 100ug/vial
EUR 334

Anti-RBMS3 antibody

STJ119365 100 µl
EUR 277

Anti-RBMS3 antibody

STJ193014 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RBMS3

RBMS3 siRNA

20-abx931100
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBMS3 siRNA

20-abx931101
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RBMS3 Antibody, HRP conjugated

1-CSB-PA761548LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBMS3 Antibody, FITC conjugated

1-CSB-PA761548LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBMS3 Antibody, Biotin conjugated

1-CSB-PA761548LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBMS3 Blocking Peptide

33R-3651 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1317

RBMS3 Blocking Peptide

33R-7382 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4803

RBMS3 Blocking Peptide

33R-8991 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1318

RBMS3 Blocking Peptide

33R-9391 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4798

RBMS3 Blocking Peptide

DF8599-BP 1mg
EUR 195

RBMS3 cloning plasmid

CSB-CL761548HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgggcaaacgcctggatcagccacaaatgtacccccagtacacttactactatcctcattatctccaaaccaagcagtcctatgcaccagctccccaccccatggctcctcccagccccagcacaaacagcagcagcaacaacagcagcaacaacagcagcggggaacagttga
  • Show more
Description: A cloning plasmid for the RBMS3 gene.

Anti-RBMS3 (3B11)

YF-MA18198 100 ug
EUR 363
Description: Mouse monoclonal to RBMS3

Mouse RBMS3 shRNA Plasmid

20-abx980489
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Rbms3 ELISA KIT

ELI-52240m 96 Tests
EUR 865

Human RBMS3 ELISA KIT

ELI-39189h 96 Tests
EUR 824

Human RBMS3 shRNA Plasmid

20-abx959069
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RBMS3 Recombinant Protein (Human)

RP042793 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167261 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167264 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167267 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167270 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167273 100 ug Ask for price

RBMS3 Recombinant Protein (Mouse)

RP167276 100 ug Ask for price

RBMS3 ORF Vector (Human) (pORF)

ORF014265 1.0 ug DNA
EUR 354

Rbms3 ORF Vector (Mouse) (pORF)

ORF055755 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055756 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055757 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055758 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055759 1.0 ug DNA
EUR 506

Rbms3 ORF Vector (Mouse) (pORF)

ORF055760 1.0 ug DNA
EUR 506

RBMS3 sgRNA CRISPR Lentivector set (Human)

K1796701 3 x 1.0 ug
EUR 339

Rbms3 sgRNA CRISPR Lentivector set (Mouse)

K4029901 3 x 1.0 ug
EUR 339

RBMS3-AS1 ORF Vector (Human) (pORF)

ORF028771 1.0 ug DNA Ask for price

RBMS3-AS2 ORF Vector (Human) (pORF)

ORF028772 1.0 ug DNA Ask for price

RBMS3-AS3 ORF Vector (Human) (pORF)

ORF028773 1.0 ug DNA Ask for price

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1796702 1.0 ug DNA
EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1796703 1.0 ug DNA
EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1796704 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4029902 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4029903 1.0 ug DNA
EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4029904 1.0 ug DNA
EUR 154

RBMS3 Protein Vector (Human) (pPB-C-His)

PV057057 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPB-N-His)

PV057058 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPM-C-HA)

PV057059 500 ng
EUR 481

RBMS3 Protein Vector (Human) (pPM-C-His)

PV057060 500 ng
EUR 481

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223018 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223019 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223020 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223021 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223022 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223023 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223024 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223025 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223026 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223027 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223028 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223029 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223030 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223031 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223032 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223033 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223034 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223035 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223036 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223037 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)

PV223038 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)

PV223039 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)

PV223040 500 ng
EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)

PV223041 500 ng
EUR 603

Rbms3 3'UTR GFP Stable Cell Line

TU167641 1.0 ml Ask for price

RBMS3 3'UTR Luciferase Stable Cell Line

TU019623 1.0 ml
EUR 1394

Rbms3 3'UTR Luciferase Stable Cell Line

TU117641 1.0 ml Ask for price

RBMS3 3'UTR GFP Stable Cell Line

TU069623 1.0 ml
EUR 1394

RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody

20-abx123014
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody

20-abx333747
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody

20-abx212353
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA Binding Motif Single Stranded Interacting Protein 3 (RBMS3) Antibody

20-abx212498
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

RBMS3 Rabbit Polyclonal Antibody