RBMS3 Rabbit Polyclonal Antibody

RBMS3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

RBMS3 Polyclonal Antibody
ABP60117-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody
ABP60117-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RBMS3 protein Applications tips:
Description: A polyclonal antibody for detection of RBMS3 from Human, Mouse. This RBMS3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBMS3 protein

RBMS3 Polyclonal Antibody
ES11856-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBMS3 Polyclonal Antibody
ES11856-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RBMS3 Rabbit pAb
A17142-100ul	Abclonal	100 ul	EUR 308

RBMS3 Rabbit pAb
A17142-200ul	Abclonal	200 ul	EUR 459

RBMS3 Rabbit pAb
A17142-20ul	Abclonal	20 ul	EUR 183

RBMS3 Rabbit pAb
A17142-50ul	Abclonal	50 ul	EUR 223

RBMS3 antibody
70R-1317	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the N terminal of RBMS3

RBMS3 antibody
70R-1318	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RBMS3 antibody raised against the C terminal of RBMS3

RBMS3 Antibody
37025-100ul	SAB	100ul	EUR 252

RBMS3 Antibody
1-CSB-PA998451	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:100

RBMS3 Antibody
1-CSB-PA761548LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

RBMS3 Antibody
DF8599	Affbiotech	200ul	EUR 304
Description: RBMS3 Antibody detects endogenous levels of total RBMS3.

RBMS3 Antibody
1-CSB-PA579163	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RBMS3 antibody
70R-4798	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 antibody
70R-4803	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

RBMS3 Antibody
ABD8599	Lifescience Market	100 ug	EUR 438

RBMS3 Polyclonal Antibody, HRP Conjugated
A68984	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

RBMS3 Polyclonal Antibody, FITC Conjugated
A68985	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

RBMS3 Polyclonal Antibody, Biotin Conjugated
A68986	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

Anti-RBMS3 Antibody
A12416	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RBMS3 Antibody. Validated in WB and tested in Human, Mouse.

Anti-RBMS3 Antibody
A12416-3	BosterBio	100ug/vial	EUR 334

Anti-RBMS3 antibody
STJ119365	St John's Laboratory	100 µl	EUR 277

Anti-RBMS3 antibody
STJ193014	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RBMS3

RBMS3 siRNA
20-abx931100	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBMS3 siRNA
20-abx931101	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RBMS3 Antibody, HRP conjugated
1-CSB-PA761548LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RBMS3 Antibody, FITC conjugated
1-CSB-PA761548LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RBMS3 Antibody, Biotin conjugated
1-CSB-PA761548LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RBMS3 Blocking Peptide
33R-3651	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1317

RBMS3 Blocking Peptide
33R-8991	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1318

RBMS3 Blocking Peptide
33R-9391	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4798

RBMS3 Blocking Peptide
33R-7382	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4803

RBMS3 Blocking Peptide
DF8599-BP	Affbiotech	1mg	EUR 195

RBMS3 cloning plasmid
CSB-CL761548HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1302 Sequence: atgggcaaacgcctggatcagccacaaatgtacccccagtacacttactactatcctcattatctccaaaccaagcagtcctatgcaccagctccccaccccatggctcctcccagccccagcacaaacagcagcagcaacaacagcagcaacaacagcagcggggaacagttga Show more
Description: A cloning plasmid for the RBMS3 gene.

Anti-RBMS3 (3B11)
YF-MA18198	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RBMS3

Mouse Rbms3 ELISA KIT
ELI-52240m	Lifescience Market	96 Tests	EUR 865

Human RBMS3 shRNA Plasmid
20-abx959069	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RBMS3 shRNA Plasmid
20-abx980489	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RBMS3 ELISA KIT
ELI-39189h	Lifescience Market	96 Tests	EUR 824

RBMS3 Recombinant Protein (Human)
RP042793	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167261	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167264	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167267	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167270	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167273	ABM	100 ug	Ask for price

RBMS3 Recombinant Protein (Mouse)
RP167276	ABM	100 ug	Ask for price

RBMS3 ORF Vector (Human) (pORF)
ORF014265	ABM	1.0 ug DNA	EUR 354

Rbms3 ORF Vector (Mouse) (pORF)
ORF055755	ABM	1.0 ug DNA	EUR 506

Rbms3 ORF Vector (Mouse) (pORF)
ORF055756	ABM	1.0 ug DNA	EUR 506

Rbms3 ORF Vector (Mouse) (pORF)
ORF055757	ABM	1.0 ug DNA	EUR 506

Rbms3 ORF Vector (Mouse) (pORF)
ORF055758	ABM	1.0 ug DNA	EUR 506

Rbms3 ORF Vector (Mouse) (pORF)
ORF055759	ABM	1.0 ug DNA	EUR 506

Rbms3 ORF Vector (Mouse) (pORF)
ORF055760	ABM	1.0 ug DNA	EUR 506

RBMS3 sgRNA CRISPR Lentivector set (Human)
K1796701	ABM	3 x 1.0 ug	EUR 339

Rbms3 sgRNA CRISPR Lentivector set (Mouse)
K4029901	ABM	3 x 1.0 ug	EUR 339

RBMS3-AS1 ORF Vector (Human) (pORF)
ORF028771	ABM	1.0 ug DNA	Ask for price

RBMS3-AS2 ORF Vector (Human) (pORF)
ORF028772	ABM	1.0 ug DNA	Ask for price

RBMS3-AS3 ORF Vector (Human) (pORF)
ORF028773	ABM	1.0 ug DNA	Ask for price

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1796702	ABM	1.0 ug DNA	EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1796703	ABM	1.0 ug DNA	EUR 154

RBMS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1796704	ABM	1.0 ug DNA	EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4029902	ABM	1.0 ug DNA	EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4029903	ABM	1.0 ug DNA	EUR 154

Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4029904	ABM	1.0 ug DNA	EUR 154

RBMS3 Protein Vector (Human) (pPB-C-His)
PV057057	ABM	500 ng	EUR 481

RBMS3 Protein Vector (Human) (pPB-N-His)
PV057058	ABM	500 ng	EUR 481

RBMS3 Protein Vector (Human) (pPM-C-HA)
PV057059	ABM	500 ng	EUR 481

RBMS3 Protein Vector (Human) (pPM-C-His)
PV057060	ABM	500 ng	EUR 481

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223018	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223019	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223020	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223021	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223022	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223023	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223024	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223025	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223026	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223027	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223028	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223029	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223030	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223031	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223032	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223033	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223034	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223035	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223036	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223037	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-C-His)
PV223038	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPB-N-His)
PV223039	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-HA)
PV223040	ABM	500 ng	EUR 603

RBMS3 Protein Vector (Mouse) (pPM-C-His)
PV223041	ABM	500 ng	EUR 603

Rbms3 3'UTR Luciferase Stable Cell Line
TU117641	ABM	1.0 ml	Ask for price

Rbms3 3'UTR GFP Stable Cell Line
TU167641	ABM	1.0 ml	Ask for price

RBMS3 3'UTR GFP Stable Cell Line
TU069623	ABM	1.0 ml	EUR 1394

RBMS3 3'UTR Luciferase Stable Cell Line
TU019623	ABM	1.0 ml	EUR 1394

RBMS3 Rabbit Polyclonal Antibody