DVL1 Rabbit Polyclonal Antibody

DVL1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DVL1 Polyclonal Antibody

ABP58434-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DVL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DVL1 from Human, Mouse, Rat. This DVL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DVL1 protein

DVL1 Polyclonal Antibody

ES11836-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DVL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DVL1 Polyclonal Antibody

ES11836-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DVL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DVL1 Rabbit pAb

A10536-100ul 100 ul
EUR 308

DVL1 Rabbit pAb

A10536-200ul 200 ul
EUR 459

DVL1 Rabbit pAb

A10536-20ul 20 ul
EUR 183

DVL1 Rabbit pAb

A10536-50ul 50 ul
EUR 223

Polyclonal DVL1 Antibody (Center)

APC00112G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal DVL1 Antibody (Center)

AMM06980G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

DVL1 antibody

70R-1638 100 ug
EUR 377
Description: Rabbit polyclonal DVL1 antibody

DVL1 antibody

70R-1639 100 ug
EUR 377
Description: Rabbit polyclonal DVL1 antibody

DVL1 Antibody

43257-100ul 100ul
EUR 252

DVL1 Antibody

DF7515 200ul
EUR 304
Description: DVL1 Antibody detects endogenous levels of total DVL1.

DVL1 Antibody

ABD7515 100 ug
EUR 438

DVL1 antibody

PAab09841 100 ug
EUR 386

DVL1 Conjugated Antibody

C43257 100ul
EUR 397

anti- DVL1 antibody

FNab09841 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: dishevelled, dsh homolog 1
  • Uniprot ID: O14640
  • Gene ID: 1855
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against DVL1

anti- DVL1 antibody

LSMab09841 100 ug
EUR 386

Anti-DVL1 antibody

STJ116411 100 µl
EUR 277
Description: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.

Anti-DVL1 antibody

STJ192994 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DVL1

DVL1 siRNA

20-abx901607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DVL1 siRNA

20-abx914783
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DVL1 siRNA

20-abx914784
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DVL1

YF-PA27212 50 ug
EUR 363
Description: Mouse polyclonal to DVL1

Polyclonal DVL1 / DVL / Dishevelled Antibody (aa20-32)

APC00111G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DVL1 / DVL / Dishevelled (aa20-32). This antibody is tested and proven to work in the following applications:

Anti-Dishevelled/Dvl1 Antibody

A03533-1 100ug/vial
EUR 334

Anti-Dvl1 (mouse) antibody

STJ72776 100 µg
EUR 359

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human)

4-PAJ540Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1)

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse)

4-PAJ540Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1)

DVL1 Blocking Peptide

33R-5088 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DVL1 antibody, catalog no. 70R-1638

DVL1 Blocking Peptide

33R-1019 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACADM antibody, catalog no. 70R-2483

DVL1 Blocking Peptide

DF7515-BP 1mg
EUR 195

DVL1 cloning plasmid

CSB-CL007284HU-10ug 10ug
EUR 483
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtgg
  • Show more
Description: A cloning plasmid for the DVL1 gene.

anti-Dishevelled / Dvl1

YF-PA11452 50 ul
EUR 363
Description: Mouse polyclonal to Dishevelled / Dvl1

anti-Dishevelled / Dvl1

YF-PA11453 100 ug
EUR 403
Description: Rabbit polyclonal to Dishevelled / Dvl1

anti-Dishevelled / Dvl1

YF-PA23616 50 ul
EUR 334
Description: Mouse polyclonal to Dishevelled / Dvl1

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC

4-PAJ540Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Biotinylated

4-PAJ540Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Cy3

4-PAJ540Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), FITC

4-PAJ540Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), HRP

4-PAJ540Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), PE

4-PAJ540Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC

4-PAJ540Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Biotinylated

4-PAJ540Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Cy3

4-PAJ540Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), FITC

4-PAJ540Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), HRP

4-PAJ540Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), PE

4-PAJ540Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

Human DVL1 ELISA Kit

ELA-E15104h 96 Tests
EUR 824

DVL1 ELISA KIT|Human

EF005905 96 Tests
EUR 689

Rat DVL1 shRNA Plasmid

20-abx986842
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DVL1 shRNA Plasmid

20-abx970078
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DVL1 shRNA Plasmid

20-abx951301
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DVL1 Recombinant Protein (Human)

RP009988 100 ug Ask for price

DVL1 Recombinant Protein (Rat)

RP198854 100 ug Ask for price

DVL1 Recombinant Protein (Mouse)

RP130349 100 ug Ask for price

Dishevelled, Dsh Homolog 1 (DVL1) Antibody

20-abx102614
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dishevelled, Dsh Homolog 1 (DVL1) Antibody

20-abx102615
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC-Cy7

4-PAJ540Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Lys285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAJ540Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DVL1 (Arg150~Ser332)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

Dvl1 ORF Vector (Rat) (pORF)

ORF066286 1.0 ug DNA
EUR 506

DVL1 ORF Vector (Human) (pORF)

ORF003330 1.0 ug DNA
EUR 95

Dvl1 ORF Vector (Mouse) (pORF)

ORF043451 1.0 ug DNA
EUR 506

DVL1 ELISA Kit (Human) (OKEH02504)

OKEH02504 96 Wells
EUR 779
Description: Description of target: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.021 ng/mL

DVL1 sgRNA CRISPR Lentivector set (Human)

K0642301 3 x 1.0 ug
EUR 339

Dvl1 sgRNA CRISPR Lentivector set (Rat)

K6997701 3 x 1.0 ug
EUR 339

Dvl1 sgRNA CRISPR Lentivector set (Mouse)

K3976501 3 x 1.0 ug
EUR 339

Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

4-RPJ540Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14640
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.0kDa
  • Isoelectric Point: 11.1
Description: Recombinant Human Dishevelled, Dsh Homolog 1 expressed in: E.coli

Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

4-RPJ540Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51141
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.0kDa
  • Isoelectric Point: 8.1
Description: Recombinant Mouse Dishevelled, Dsh Homolog 1 expressed in: E.coli

Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

abx026731-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

abx026731-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Segment Polarity Protein Dishevelled Homolog DVL-1 (Dvl1) Antibody

abx431219-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Mouse Dishevelled, Dsh Homolog 1 (DVL1) Protein

20-abx066347
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Dishevelled, Dsh Homolog 1 (DVL1) Protein

20-abx066348
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

DVL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0642302 1.0 ug DNA
EUR 154

DVL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0642303 1.0 ug DNA
EUR 154

DVL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0642304 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6997702 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6997703 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6997704 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3976502 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3976503 1.0 ug DNA
EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3976504 1.0 ug DNA
EUR 154

DVL1 Protein Vector (Mouse) (pPB-C-His)

PV173802 500 ng
EUR 1065

DVL1 Protein Vector (Mouse) (pPB-N-His)

PV173803 500 ng
EUR 1065

DVL1 Protein Vector (Mouse) (pPM-C-HA)

PV173804 500 ng
EUR 1065

DVL1 Protein Vector (Mouse) (pPM-C-His)

PV173805 500 ng
EUR 1065

DVL1 Protein Vector (Rat) (pPB-C-His)

PV265142 500 ng
EUR 1166

DVL1 Protein Vector (Rat) (pPB-N-His)

PV265143 500 ng
EUR 1166

DVL1 Protein Vector (Rat) (pPM-C-HA)

PV265144 500 ng
EUR 1166

DVL1 Protein Vector (Rat) (pPM-C-His)

PV265145 500 ng
EUR 1166

DVL1 Protein Vector (Human) (pPB-C-His)

PV013317 500 ng
EUR 329

DVL1 Protein Vector (Human) (pPB-N-His)

PV013318 500 ng
EUR 329

DVL1 Protein Vector (Human) (pPM-C-HA)

PV013319 500 ng
EUR 329

DVL1 Protein Vector (Human) (pPM-C-His)

PV013320 500 ng
EUR 329

Dvl1 3'UTR GFP Stable Cell Line

TU155471 1.0 ml Ask for price

Dvl1 3'UTR Luciferase Stable Cell Line

TU105471 1.0 ml Ask for price

Dvl1 3'UTR Luciferase Stable Cell Line

TU203704 1.0 ml Ask for price

Dvl1 3'UTR GFP Stable Cell Line

TU253704 1.0 ml Ask for price

DVL1 3'UTR GFP Stable Cell Line

TU056444 1.0 ml
EUR 1394

DVL1 3'UTR Luciferase Stable Cell Line

TU006444 1.0 ml
EUR 1394

DVL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666133 1.0 ug DNA
EUR 1355

DVL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666137 1.0 ug DNA
EUR 1355

DVL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666138 1.0 ug DNA
EUR 1355

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

DVL1 Rabbit Polyclonal Antibody