DVL1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
DVL1 Polyclonal Antibody |
ABP58434-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DVL1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DVL1 from Human, Mouse, Rat. This DVL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DVL1 protein |
DVL1 Polyclonal Antibody |
ABP58434-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DVL1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DVL1 from Human, Mouse, Rat. This DVL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DVL1 protein |
DVL1 Polyclonal Antibody |
ABP58434-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DVL1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DVL1 from Human, Mouse, Rat. This DVL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DVL1 protein |
DVL1 Rabbit pAb |
A10536-100ul |
Abclonal |
100 ul |
EUR 308 |
DVL1 Rabbit pAb |
A10536-200ul |
Abclonal |
200 ul |
EUR 459 |
DVL1 Rabbit pAb |
A10536-20ul |
Abclonal |
20 ul |
EUR 183 |
DVL1 Rabbit pAb |
A10536-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal DVL1 Antibody (Center) |
AMM06980G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal DVL1 Antibody (Center) |
APC00112G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications: |
DVL1 Antibody |
43257-100ul |
SAB |
100ul |
EUR 252 |
DVL1 antibody |
70R-1638 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DVL1 antibody |
DVL1 antibody |
70R-1639 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DVL1 antibody |
DVL1 Antibody |
DF7515 |
Affbiotech |
200ul |
EUR 304 |
Description: DVL1 Antibody detects endogenous levels of total DVL1. |
DVL1 Conjugated Antibody |
C43257 |
SAB |
100ul |
EUR 397 |
anti- DVL1 antibody |
FNab09841 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- Immunogen: dishevelled, dsh homolog 1
- Uniprot ID: O14640
- Gene ID: 1855
- Research Area: Neuroscience, Signal Transduction, Developmental biology
|
Description: Antibody raised against DVL1 |
Anti-DVL1 antibody |
STJ116411 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development. |
Anti-DVL1 antibody |
STJ192994 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DVL1 |
DVL1 siRNA |
20-abx901607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DVL1 siRNA |
20-abx914783 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DVL1 siRNA |
20-abx914784 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DVL1 |
YF-PA27212 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DVL1 |
Polyclonal DVL1 / DVL / Dishevelled Antibody (aa20-32) |
APC00111G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DVL1 / DVL / Dishevelled (aa20-32). This antibody is tested and proven to work in the following applications: |
Anti-Dishevelled/Dvl1 Antibody |
A03533-1 |
BosterBio |
100ug/vial |
EUR 334 |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human) |
4-PAJ540Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1) |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse) |
4-PAJ540Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1) |
DVL1 cloning plasmid |
CSB-CL007284HU-10ug |
Cusabio |
10ug |
EUR 483 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1335
- Sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtgg
- Show more
|
Description: A cloning plasmid for the DVL1 gene. |
DVL1 Blocking Peptide |
33R-5088 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DVL1 antibody, catalog no. 70R-1638 |
DVL1 Blocking Peptide |
33R-1019 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACADM antibody, catalog no. 70R-2483 |
DVL1 Blocking Peptide |
DF7515-BP |
Affbiotech |
1mg |
EUR 195 |
anti-Dishevelled / Dvl1 |
YF-PA11452 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Dishevelled / Dvl1 |
anti-Dishevelled / Dvl1 |
YF-PA11453 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Dishevelled / Dvl1 |
anti-Dishevelled / Dvl1 |
YF-PA23616 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Dishevelled / Dvl1 |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC |
4-PAJ540Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Biotinylated |
4-PAJ540Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Cy3 |
4-PAJ540Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), FITC |
4-PAJ540Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), HRP |
4-PAJ540Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), PE |
4-PAJ540Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC |
4-PAJ540Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAJ540Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Cy3 |
4-PAJ540Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), FITC |
4-PAJ540Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), HRP |
4-PAJ540Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), PE |
4-PAJ540Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE. |
Rat DVL1 shRNA Plasmid |
20-abx986842 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DVL1 shRNA Plasmid |
20-abx951301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse DVL1 shRNA Plasmid |
20-abx970078 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DVL1 Recombinant Protein (Human) |
RP009988 |
ABM |
100 ug |
Ask for price |
DVL1 Recombinant Protein (Rat) |
RP198854 |
ABM |
100 ug |
Ask for price |
DVL1 Recombinant Protein (Mouse) |
RP130349 |
ABM |
100 ug |
Ask for price |
Dishevelled, Dsh Homolog 1 (DVL1) Antibody |
20-abx102614 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dishevelled, Dsh Homolog 1 (DVL1) Antibody |
20-abx102615 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ540Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Lys285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7. |
Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAJ540Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DVL1 (Arg150~Ser332)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7. |
DVL1 ORF Vector (Human) (pORF) |
ORF003330 |
ABM |
1.0 ug DNA |
EUR 95 |
Dvl1 ORF Vector (Rat) (pORF) |
ORF066286 |
ABM |
1.0 ug DNA |
EUR 506 |
Dvl1 ORF Vector (Mouse) (pORF) |
ORF043451 |
ABM |
1.0 ug DNA |
EUR 506 |
DVL1 ELISA Kit (Human) (OKEH02504) |
OKEH02504 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.021 ng/mL |
DVL1 sgRNA CRISPR Lentivector set (Human) |
K0642301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dvl1 sgRNA CRISPR Lentivector set (Mouse) |
K3976501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dvl1 sgRNA CRISPR Lentivector set (Rat) |
K6997701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Dishevelled, Dsh Homolog 1 (DVL1) |
4-RPJ540Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O14640
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.0kDa
- Isoelectric Point: 11.1
|
Description: Recombinant Human Dishevelled, Dsh Homolog 1 expressed in: E.coli |
Recombinant Dishevelled, Dsh Homolog 1 (DVL1) |
4-RPJ540Mu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P51141
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.0kDa
- Isoelectric Point: 8.1
|
Description: Recombinant Mouse Dishevelled, Dsh Homolog 1 expressed in: E.coli |
Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody |
abx026731-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody |
abx026731-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Segment Polarity Protein Dishevelled Homolog DVL-1 (Dvl1) Antibody |
abx431219-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
DVL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0642302 |
ABM |
1.0 ug DNA |
EUR 154 |
DVL1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0642303 |
ABM |
1.0 ug DNA |
EUR 154 |
DVL1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0642304 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse Dishevelled, Dsh Homolog 1 (DVL1) Protein |
20-abx066347 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Dishevelled, Dsh Homolog 1 (DVL1) Protein |
20-abx066348 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3976502 |
ABM |
1.0 ug DNA |
EUR 154 |
Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3976503 |
ABM |
1.0 ug DNA |
EUR 154 |
Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3976504 |
ABM |
1.0 ug DNA |
EUR 154 |
Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6997702 |
ABM |
1.0 ug DNA |
EUR 154 |
Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6997703 |
ABM |
1.0 ug DNA |
EUR 154 |
Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6997704 |
ABM |
1.0 ug DNA |
EUR 154 |
DVL1 Protein Vector (Mouse) (pPB-C-His) |
PV173802 |
ABM |
500 ng |
EUR 1065 |
DVL1 Protein Vector (Mouse) (pPB-N-His) |
PV173803 |
ABM |
500 ng |
EUR 1065 |
DVL1 Protein Vector (Mouse) (pPM-C-HA) |
PV173804 |
ABM |
500 ng |
EUR 1065 |
DVL1 Protein Vector (Mouse) (pPM-C-His) |
PV173805 |
ABM |
500 ng |
EUR 1065 |
DVL1 Protein Vector (Human) (pPB-C-His) |
PV013317 |
ABM |
500 ng |
EUR 329 |
DVL1 Protein Vector (Human) (pPB-N-His) |
PV013318 |
ABM |
500 ng |
EUR 329 |
DVL1 Protein Vector (Human) (pPM-C-HA) |
PV013319 |
ABM |
500 ng |
EUR 329 |
DVL1 Protein Vector (Human) (pPM-C-His) |
PV013320 |
ABM |
500 ng |
EUR 329 |
DVL1 Protein Vector (Rat) (pPB-C-His) |
PV265142 |
ABM |
500 ng |
EUR 1166 |
DVL1 Protein Vector (Rat) (pPB-N-His) |
PV265143 |
ABM |
500 ng |
EUR 1166 |
DVL1 Protein Vector (Rat) (pPM-C-HA) |
PV265144 |
ABM |
500 ng |
EUR 1166 |
DVL1 Protein Vector (Rat) (pPM-C-His) |
PV265145 |
ABM |
500 ng |
EUR 1166 |
Dvl1 3'UTR Luciferase Stable Cell Line |
TU203704 |
ABM |
1.0 ml |
Ask for price |
Dvl1 3'UTR GFP Stable Cell Line |
TU155471 |
ABM |
1.0 ml |
Ask for price |
DVL1 3'UTR Luciferase Stable Cell Line |
TU006444 |
ABM |
1.0 ml |
EUR 1394 |
Dvl1 3'UTR Luciferase Stable Cell Line |
TU105471 |
ABM |
1.0 ml |
Ask for price |
DVL1 3'UTR GFP Stable Cell Line |
TU056444 |
ABM |
1.0 ml |
EUR 1394 |
Dvl1 3'UTR GFP Stable Cell Line |
TU253704 |
ABM |
1.0 ml |
Ask for price |
DVL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666133 |
ABM |
1.0 ug DNA |
EUR 1355 |
DVL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666137 |
ABM |
1.0 ug DNA |
EUR 1355 |
DVL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666138 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
DVL1 Rabbit Polyclonal Antibody