CD3G Rabbit Polyclonal Antibody

CD3G Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

CD3G Polyclonal Antibody
ABP58067-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein
CD3G Polyclonal Antibody
ABP58067-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein
CD3G Polyclonal Antibody
ES11786-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD3G from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CD3G Polyclonal Antibody
ES11786-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD3G from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CD3G Rabbit pAb
A1938-100ul 100 ul
EUR 308
CD3G Rabbit pAb
A1938-200ul 200 ul
EUR 459
CD3G Rabbit pAb
A1938-20ul 20 ul
EUR 183
CD3G Rabbit pAb
A1938-50ul 50 ul Ask for price
CD3G antibody
70R-16274 50 ul
EUR 435
Description: Rabbit polyclonal CD3G antibody
CD3G Antibody
49836-100ul 100ul
EUR 333
CD3G Antibody
49836-50ul 50ul
EUR 239
CD3G Antibody
45216-100ul 100ul
EUR 252
CD3G Antibody
45216-50ul 50ul
EUR 187
CD3G Antibody
1-CSB-PA004933GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
CD3G Antibody
1-CSB-PA004933LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
CD3G Antibody
DF8098 200ul
EUR 304
Description: CD3G Antibody detects endogenous levels of total CD3G.
CD3g antibody
70R-51259 100 ul
EUR 244
Description: Purified Polyclonal CD3g antibody
CD3G Antibody
ABD8098 100 ug
EUR 438
CD3G Antibody
ABD8099 100 ug
EUR 438
CD3G
PR27294 5 ug
EUR 318
Human CD3G Antibody
35697-05111 150 ug
EUR 261
CD3G Conjugated Antibody
C49836 100ul
EUR 397
Anti-CD3G antibody
STJ28124 100 µl
EUR 277
Description: The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency.
Anti-CD3G Antibody
STJ500451 100 µg
EUR 476
Anti-CD3G antibody
STJ192944 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CD3G
Anti-CD3G antibody
STJ73095 100 µg
EUR 359
Cd3g/ Rat Cd3g ELISA Kit
ELI-25761r 96 Tests
EUR 886
Polyclonal Goat Anti-CD3G Antibody (internal region)
APG00967G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD3G (internal region). This antibody is tested and proven to work in the following applications:
CD3G siRNA
20-abx900911
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD3G siRNA
20-abx911027
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD3G siRNA
20-abx911028
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD3G Antibody, HRP conjugated
1-CSB-PA004933LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CD3G Antibody, FITC conjugated
1-CSB-PA004933LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CD3G Antibody, Biotin conjugated
1-CSB-PA004933LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CD3G recombinant monoclonal antibody
A5842 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human CD3G for WB,ELISA
Anti-CD3G Antibody (Biotin)
STJ500466 100 µg
EUR 586
Anti-CD3G Antibody (FITC)
STJ500467 100 µg
EUR 586
CD3G Blocking Peptide
DF8098-BP 1mg
EUR 195
CD3G, human recombinant
7313-100
EUR 370
CD3g Blocking Peptide
20-abx064134
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CD3G cloning plasmid
CSB-CL004933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGG
  • Show more
Description: A cloning plasmid for the CD3G gene.
Human CD3G Antibody (Biotin Conjugate)
35697-05121 150 ug
EUR 369
Human CD3G AssayLite Antibody (FITC Conjugate)
35697-05141 150 ug
EUR 428
Human CD3G AssayLite Antibody (RPE Conjugate)
35697-05151 150 ug
EUR 428
Human CD3G AssayLite Antibody (APC Conjugate)
35697-05161 150 ug
EUR 428
Human CD3G AssayLite Antibody (PerCP Conjugate)
35697-05171 150 ug
EUR 471
CD3G protein (His tag)
80R-2704 100 ug
EUR 322
Description: Purified recombinant CD3G protein (His tag)
Human CD3G ELISA Kit
ELA-E10023h 96 Tests
EUR 824
Mouse Cd3g ELISA KIT
ELI-10625m 96 Tests
EUR 865
Human CD3G ELISA KIT
ELI-10660h 96 Tests
EUR 824
Rat CD3G shRNA Plasmid
20-abx989067
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CD3G shRNA Plasmid
20-abx969567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CD3G shRNA Plasmid
20-abx950646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine CD3G ELISA KIT
ELI-50827b 96 Tests
EUR 928
CD3G Recombinant Protein (Human)
RP037918 100 ug Ask for price
CD3G Recombinant Protein (Rat)
RP193961 100 ug Ask for price
CD3G Recombinant Protein (Mouse)
RP122588 100 ug Ask for price
Cd3g ORF Vector (Rat) (pORF)
ORF064655 1.0 ug DNA
EUR 506
CD3G ORF Vector (Human) (pORF)
ORF012640 1.0 ug DNA
EUR 95
Cd3g ORF Vector (Mouse) (pORF)
ORF040864 1.0 ug DNA
EUR 506
CD3G ELISA Kit (Bovine) (OKEH07517)
OKEH07517 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
CD3G ELISA Kit (Pig) (OKEH07518)
OKEH07518 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
CD3G ELISA Kit (Human) (OKEI00333)
OKEI00333 96 Wells
EUR 767
Description: Description of target: The CD3 complex mediates signal transduction. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
CD3G sgRNA CRISPR Lentivector set (Human)
K0399801 3 x 1.0 ug
EUR 339
Cd3g sgRNA CRISPR Lentivector set (Rat)
K6288201 3 x 1.0 ug
EUR 339
Cd3g sgRNA CRISPR Lentivector set (Mouse)
K3425401 3 x 1.0 ug
EUR 339
h CD3g (6His) inducible lentiviral particles
LVP1093 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD3g (6His) (human CD3g molecule), [alternative names: CD3-GAMMA; IMD17; T3G]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000073.2 . It contains a RFP-Blasticidin dual selection marker.
CD3G CD3 Gamma Human Recombinant Protein
PROTP09693 Regular: 20ug
EUR 317
Description: CD3G Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 117 amino acids (23-116a.a.) and having a molecular mass of 13.1kDa. CD3G is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3g) Antibody
20-abx007885
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
20-abx111481
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
20-abx123523
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
20-abx149086
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
abx028446-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
abx028446-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody
20-abx338816
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody
abx431152-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]
VAng-1294Lsx-1mg 1 mg
EUR 7749
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))
Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc]
VAng-1294Lsx-50g 50 µg
EUR 1013
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G))
Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]
VAng-1295Lsx-100g 100 µg
EUR 1013
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))
Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc]
VAng-1295Lsx-1mg 1 mg
EUR 6402
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G))
CD3G sgRNA CRISPR Lentivector (Human) (Target 1)
K0399802 1.0 ug DNA
EUR 154
CD3G sgRNA CRISPR Lentivector (Human) (Target 2)
K0399803 1.0 ug DNA
EUR 154
CD3G sgRNA CRISPR Lentivector (Human) (Target 3)
K0399804 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 1)
K6288202 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 2)
K6288203 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 3)
K6288204 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3425402 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3425403 1.0 ug DNA
EUR 154
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3425404 1.0 ug DNA
EUR 154
CD3G Protein Vector (Mouse) (pPB-C-His)
PV163454 500 ng
EUR 603
CD3G Protein Vector (Mouse) (pPB-N-His)
PV163455 500 ng
EUR 603
CD3G Protein Vector (Mouse) (pPM-C-HA)
PV163456 500 ng
EUR 603
CD3G Protein Vector (Mouse) (pPM-C-His)
PV163457 500 ng
EUR 603
CD3G Protein Vector (Rat) (pPB-C-His)
PV258618 500 ng
EUR 603
CD3G Protein Vector (Rat) (pPB-N-His)
PV258619 500 ng
EUR 603
CD3G Protein Vector (Rat) (pPM-C-HA)
PV258620 500 ng
EUR 603
CD3G Protein Vector (Rat) (pPM-C-His)
PV258621 500 ng
EUR 603
CD3G Protein Vector (Human) (pPB-C-His)
PV050557 500 ng
EUR 481
CD3G Protein Vector (Human) (pPB-N-His)
PV050558 500 ng
EUR 481
CD3G Protein Vector (Human) (pPM-C-HA)
PV050559 500 ng
EUR 481
CD3G Protein Vector (Human) (pPM-C-His)
PV050560 500 ng
EUR 481
Recombinant Human CD3G Protein, His, Insect-1mg
QP11332-HIS-1mg 1mg
EUR 2757
Recombinant Human CD3G Protein, His, Insect-1ug
QP11332-HIS-1ug 1ug
EUR 155

CD3G Rabbit Polyclonal Antibody