CD3G Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
CD3G Polyclonal Antibody |
ES11786-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD3G from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CD3G Polyclonal Antibody |
ABP58067-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CD3G protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein |
CD3G Polyclonal Antibody |
ABP58067-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CD3G protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein |
CD3G Polyclonal Antibody |
ABP58067-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CD3G protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CD3G from Human, Mouse, Rat. This CD3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD3G protein |
CD3G Rabbit pAb |
A1938-100ul |
Abclonal |
100 ul |
EUR 308 |
CD3G Rabbit pAb |
A1938-200ul |
Abclonal |
200 ul |
EUR 459 |
CD3G Rabbit pAb |
A1938-20ul |
Abclonal |
20 ul |
EUR 183 |
CD3G Rabbit pAb |
A1938-50ul |
Abclonal |
50 ul |
Ask for price |
CD3g antibody |
70R-51259 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CD3g antibody |
CD3G Antibody |
49836-100ul |
SAB |
100ul |
EUR 333 |
CD3G Antibody |
49836-50ul |
SAB |
50ul |
EUR 239 |
CD3G Antibody |
45216-100ul |
SAB |
100ul |
EUR 252 |
CD3G Antibody |
45216-50ul |
SAB |
50ul |
EUR 187 |
CD3G antibody |
70R-16274 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CD3G antibody |
CD3G Antibody |
DF8098 |
Affbiotech |
200ul |
EUR 304 |
Description: CD3G Antibody detects endogenous levels of total CD3G. |
CD3G Antibody |
1-CSB-PA004933GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CD3G Antibody |
1-CSB-PA004933LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
CD3G Conjugated Antibody |
C49836 |
SAB |
100ul |
EUR 397 |
Human CD3G Antibody |
35697-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-CD3G antibody |
STJ28124 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. |
Anti-CD3G antibody |
STJ192944 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CD3G |
Polyclonal Goat Anti-CD3G Antibody (internal region) |
APG00967G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD3G (internal region). This antibody is tested and proven to work in the following applications: |
CD3G siRNA |
20-abx900911 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD3G siRNA |
20-abx911027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD3G siRNA |
20-abx911028 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD3G recombinant monoclonal antibody |
A5842 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human CD3G for WB,ELISA |
CD3G Antibody, HRP conjugated |
1-CSB-PA004933LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CD3G Antibody, FITC conjugated |
1-CSB-PA004933LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CD3G Antibody, Biotin conjugated |
1-CSB-PA004933LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD3G. Recognizes CD3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CD3G cloning plasmid |
CSB-CL004933HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 549
- Sequence: ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGG
- Show more
|
Description: A cloning plasmid for the CD3G gene. |
CD3g Blocking Peptide |
20-abx064134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD3G, human recombinant |
7313-100 |
Biovision |
|
EUR 370 |
CD3G Blocking Peptide |
DF8098-BP |
Affbiotech |
1mg |
EUR 195 |
Human CD3G Antibody (Biotin Conjugate) |
35697-05121 |
AssayPro |
150 ug |
EUR 369 |
Human CD3G AssayLite Antibody (FITC Conjugate) |
35697-05141 |
AssayPro |
150 ug |
EUR 428 |
Human CD3G AssayLite Antibody (RPE Conjugate) |
35697-05151 |
AssayPro |
150 ug |
EUR 428 |
Human CD3G AssayLite Antibody (APC Conjugate) |
35697-05161 |
AssayPro |
150 ug |
EUR 428 |
Human CD3G AssayLite Antibody (PerCP Conjugate) |
35697-05171 |
AssayPro |
150 ug |
EUR 471 |
Rat CD3G shRNA Plasmid |
20-abx989067 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CD3G shRNA Plasmid |
20-abx950646 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD3G protein (His tag) |
80R-2704 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Purified recombinant CD3G protein (His tag) |
Mouse CD3G shRNA Plasmid |
20-abx969567 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD3G Recombinant Protein (Human) |
RP037918 |
ABM |
100 ug |
Ask for price |
CD3G Recombinant Protein (Rat) |
RP193961 |
ABM |
100 ug |
Ask for price |
CD3G Recombinant Protein (Mouse) |
RP122588 |
ABM |
100 ug |
Ask for price |
Cd3g ORF Vector (Mouse) (pORF) |
ORF040864 |
ABM |
1.0 ug DNA |
EUR 506 |
CD3G ORF Vector (Human) (pORF) |
ORF012640 |
ABM |
1.0 ug DNA |
EUR 95 |
Cd3g ORF Vector (Rat) (pORF) |
ORF064655 |
ABM |
1.0 ug DNA |
EUR 506 |
CD3G ELISA Kit (Bovine) (OKEH07517) |
OKEH07517 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
CD3G ELISA Kit (Pig) (OKEH07518) |
OKEH07518 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
CD3G ELISA Kit (Human) (OKEI00333) |
OKEI00333 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: The CD3 complex mediates signal transduction. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
CD3G sgRNA CRISPR Lentivector set (Human) |
K0399801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd3g sgRNA CRISPR Lentivector set (Mouse) |
K3425401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd3g sgRNA CRISPR Lentivector set (Rat) |
K6288201 |
ABM |
3 x 1.0 ug |
EUR 339 |
CD3G CD3 Gamma Human Recombinant Protein |
PROTP09693 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: CD3G Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 117 amino acids (23-116a.a.) and having a molecular mass of 13.1kDa. CD3G is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
h CD3g (6His) inducible lentiviral particles |
LVP1093 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing C-terminal His-Tagged human target: CD3g (6His) (human CD3g molecule), [alternative names: CD3-GAMMA; IMD17; T3G]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000073.2Â . It contains a RFP-Blasticidin dual selection marker. |
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
20-abx123523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
20-abx111481 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
20-abx149086 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3g) Antibody |
20-abx007885 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
abx028446-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
abx028446-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
T-cell surface glycoprotein CD3 gamma chain (CD3G) Antibody |
20-abx338816 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
T-Cell Surface Glycoprotein CD3 Gamma Chain (CD3G) Antibody |
abx431152-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc] |
VAng-1294Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 7749 |
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G)) |
Recombinant CD3E&CD3G Heterodimer Protein (Asp 23-Asp 126 (CD3E) & Gln 23-Ser 116 (CD3G)) [Fc] |
VAng-1294Lsx-50g |
Creative Biolabs |
50 µg |
EUR 1013 |
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc,His Tag&Fc,Flag Tag, is expressed in HEK 293 cells. (Uniprot ID: NP_000724.1 (CD3E) & AAI13831 (CD3G)) |
Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc] |
VAng-1295Lsx-100g |
Creative Biolabs |
100 µg |
EUR 1013 |
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G)) |
Recombinant CD3E&CD3G Heterodimer Protein (Gln 22-Asp 117 (CD3E) & Gln 23-Thr 113 (CD3G)) [Fc] |
VAng-1295Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 6402 |
Description: Cynomolgus CD3E&CD3G Heterodimer Protein, Fc Tag, is expressed in HEK 293 cells. (Uniprot ID: Q95LI5-1 (CD3E) & Q95LI7-1 (CD3G)) |
CD3G sgRNA CRISPR Lentivector (Human) (Target 1) |
K0399802 |
ABM |
1.0 ug DNA |
EUR 154 |
CD3G sgRNA CRISPR Lentivector (Human) (Target 2) |
K0399803 |
ABM |
1.0 ug DNA |
EUR 154 |
CD3G sgRNA CRISPR Lentivector (Human) (Target 3) |
K0399804 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3425402 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3425403 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3425404 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6288202 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6288203 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd3g sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6288204 |
ABM |
1.0 ug DNA |
EUR 154 |
CD3G Protein Vector (Human) (pPB-C-His) |
PV050557 |
ABM |
500 ng |
EUR 481 |
CD3G Protein Vector (Human) (pPB-N-His) |
PV050558 |
ABM |
500 ng |
EUR 481 |
CD3G Protein Vector (Human) (pPM-C-HA) |
PV050559 |
ABM |
500 ng |
EUR 481 |
CD3G Protein Vector (Human) (pPM-C-His) |
PV050560 |
ABM |
500 ng |
EUR 481 |
Recombinant Human CD3G Protein, His, Insect-1mg |
QP11332-HIS-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human CD3G Protein, His, Insect-1ug |
QP11332-HIS-1ug |
EnQuireBio |
1ug |
EUR 155 |
Recombinant Human CD3G Protein, His, Insect-20ug |
QP11332-HIS-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human CD3G Protein, His, Insect-50ug |
QP11332-HIS-50ug |
EnQuireBio |
50ug |
EUR 1261 |
Recombinant Human CD3G Protein, His, E.coli-5ug |
QP11332-HIS-EC-5ug |
EnQuireBio |
5ug |
EUR 155 |
Recombinant Human CD3G Protein, His, Insect-5ug |
QP11332-HIS-INSECT-5ug |
EnQuireBio |
5ug |
EUR 201 |
CD3G Protein Vector (Rat) (pPB-C-His) |
PV258618 |
ABM |
500 ng |
EUR 603 |
CD3G Protein Vector (Rat) (pPB-N-His) |
PV258619 |
ABM |
500 ng |
EUR 603 |
CD3G Protein Vector (Rat) (pPM-C-HA) |
PV258620 |
ABM |
500 ng |
EUR 603 |
CD3G Protein Vector (Rat) (pPM-C-His) |
PV258621 |
ABM |
500 ng |
EUR 603 |
CD3G Rabbit Polyclonal Antibody